Incidental Mutation 'R5843:Olfr203'
ID450564
Institutional Source Beutler Lab
Gene Symbol Olfr203
Ensembl Gene ENSMUSG00000068182
Gene Nameolfactory receptor 203
SynonymsMOR182-5, GA_x54KRFPKG5P-55517445-55518365
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59298881-59304413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59303361 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 69 (D69E)
Ref Sequence ENSEMBL: ENSMUSP00000149906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000201687] [ENSMUST00000215893]
Predicted Effect probably damaging
Transcript: ENSMUST00000089305
AA Change: D70E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: D70E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1e-46 PFAM
Pfam:7tm_1 41 290 7.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201687
AA Change: D69E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144622
Gene: ENSMUSG00000048810
AA Change: D69E

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.4e-46 PFAM
Pfam:7tm_1 40 289 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215893
AA Change: D69E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Olfr203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Olfr203 APN 16 59303633 missense probably damaging 0.99
IGL02294:Olfr203 APN 16 59303612 missense probably damaging 1.00
IGL02412:Olfr203 APN 16 59303192 missense probably damaging 1.00
IGL02899:Olfr203 APN 16 59303286 missense probably damaging 1.00
R0792:Olfr203 UTSW 16 59303989 missense probably damaging 0.99
R1551:Olfr203 UTSW 16 59303403 missense probably benign 0.03
R1701:Olfr203 UTSW 16 59303288 missense probably benign 0.23
R1975:Olfr203 UTSW 16 59303728 missense probably damaging 0.98
R2272:Olfr203 UTSW 16 59303444 missense possibly damaging 0.55
R5199:Olfr203 UTSW 16 59303740 missense probably benign
R5928:Olfr203 UTSW 16 59303158 missense probably damaging 1.00
R6708:Olfr203 UTSW 16 59304053 missense probably damaging 1.00
R6747:Olfr203 UTSW 16 59303641 missense probably benign 0.03
R6894:Olfr203 UTSW 16 59303779 missense probably damaging 0.98
R7324:Olfr203 UTSW 16 59303248 missense probably benign
R7380:Olfr203 UTSW 16 59304028 missense probably damaging 1.00
R7612:Olfr203 UTSW 16 59303627 missense probably damaging 1.00
R7775:Olfr203 UTSW 16 59303251 missense probably damaging 1.00
R8010:Olfr203 UTSW 16 59303504 missense probably damaging 1.00
Z1176:Olfr203 UTSW 16 59303169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCTGGTGACTGCGTTTATTC -3'
(R):5'- ACACTCTGTTGGACATCACC -3'

Sequencing Primer
(F):5'- TCTCAGAGGAATAACAGATCTTCCAG -3'
(R):5'- TCTGTTGGACATCACCACAAGATAG -3'
Posted On2016-12-20