Incidental Mutation 'R5843:Trpm6'
ID 450565
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 043224-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5843 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18833539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1573 (T1573A)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: T1573A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: T1573A

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,537,272 (GRCm39) T93A probably damaging Het
Atp6v1h T A 1: 5,232,312 (GRCm39) probably null Het
Ccnk T C 12: 108,159,989 (GRCm39) V157A probably damaging Het
Cdh10 T C 15: 18,985,286 (GRCm39) F317L possibly damaging Het
Chn1 A G 2: 73,510,092 (GRCm39) I139T probably benign Het
Creld2 A T 15: 88,710,632 (GRCm39) D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,550,244 (GRCm39) probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Frem1 T C 4: 82,854,289 (GRCm39) D1660G probably damaging Het
Hipk3 A C 2: 104,270,569 (GRCm39) S470R possibly damaging Het
Hook2 T A 8: 85,717,912 (GRCm39) I37K probably damaging Het
Hpcal1 T C 12: 17,841,200 (GRCm39) F193L probably benign Het
Hps4 T C 5: 112,497,296 (GRCm39) probably null Het
Iqgap1 T C 7: 80,375,828 (GRCm39) N1349S probably benign Het
Khk A G 5: 31,079,275 (GRCm39) I6V possibly damaging Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Lrch3 T C 16: 32,818,896 (GRCm39) V629A probably damaging Het
Mtpn C T 6: 35,489,225 (GRCm39) D100N probably benign Het
Muc13 A G 16: 33,626,421 (GRCm39) Y320C probably damaging Het
Or2aj4 T A 16: 19,385,333 (GRCm39) Q100L probably damaging Het
Or2y1b A T 11: 49,209,076 (GRCm39) R234S probably benign Het
Or5ac21 T A 16: 59,123,724 (GRCm39) D69E probably damaging Het
Parpbp A G 10: 87,969,053 (GRCm39) L131P probably damaging Het
Prl3a1 T C 13: 27,454,093 (GRCm39) W24R probably damaging Het
Ptprk T A 10: 28,369,060 (GRCm39) N677K probably damaging Het
Rbm39 A T 2: 156,004,793 (GRCm39) D181E possibly damaging Het
Ros1 T C 10: 52,042,293 (GRCm39) T220A possibly damaging Het
Slc46a3 T C 5: 147,823,021 (GRCm39) I274V probably benign Het
Tas2r104 T A 6: 131,661,938 (GRCm39) N257I probably damaging Het
Timeless A G 10: 128,080,113 (GRCm39) probably null Het
Tmem63a T C 1: 180,800,398 (GRCm39) probably null Het
Traf5 T C 1: 191,729,446 (GRCm39) D535G possibly damaging Het
Trank1 C T 9: 111,194,928 (GRCm39) S984L possibly damaging Het
Ube3b T A 5: 114,550,360 (GRCm39) I835N probably damaging Het
Wnt16 T A 6: 22,290,947 (GRCm39) I125N probably damaging Het
Xirp2 G T 2: 67,307,129 (GRCm39) probably benign Het
Zbtb47 T C 9: 121,596,405 (GRCm39) F624S possibly damaging Het
Zc3h12c G T 9: 52,027,982 (GRCm39) T460K probably benign Het
Zfp865 C A 7: 5,033,416 (GRCm39) T467K probably benign Het
Zim1 A G 7: 6,680,697 (GRCm39) V322A possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGTCTCCATGAGGATGCTC -3'
(R):5'- TTCACTCCTCCTGGTACAAGGC -3'

Sequencing Primer
(F):5'- TCCATGAGGATGCTCCCCAC -3'
(R):5'- TACAAGGCTCTCAAGTGTGC -3'
Posted On 2016-12-20