Incidental Mutation 'R5844:Fbxo10'
ID450578
Institutional Source Beutler Lab
Gene Symbol Fbxo10
Ensembl Gene ENSMUSG00000048232
Gene NameF-box protein 10
SynonymsFBX10, LOC269529
MMRRC Submission 044062-MU
Accession Numbers

Genbank: NM_001024142; MGI: 2686937  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45034247-45084604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45058760 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 326 (S326T)
Ref Sequence ENSEMBL: ENSMUSP00000058233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052236]
Predicted Effect probably benign
Transcript: ENSMUST00000052236
AA Change: S326T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058233
Gene: ENSMUSG00000048232
AA Change: S326T

DomainStartEndE-ValueType
FBOX 6 48 1.92e-6 SMART
PbH1 198 217 8.34e3 SMART
PbH1 238 260 1.37e3 SMART
CASH 337 511 7.29e-6 SMART
PbH1 423 444 1.41e2 SMART
PbH1 467 489 1.33e3 SMART
PbH1 490 512 1.32e2 SMART
PbH1 513 535 8.34e3 SMART
PbH1 536 558 2.87e1 SMART
CASH 536 672 5.49e1 SMART
PbH1 559 581 1.25e1 SMART
PbH1 582 604 2.64e2 SMART
PbH1 605 627 6.05e3 SMART
PbH1 628 650 2.46e2 SMART
PbH1 651 673 2.14e2 SMART
CASH 681 804 6.58e1 SMART
PbH1 713 735 6.52e2 SMART
PbH1 736 758 5.92e2 SMART
PbH1 760 782 1.13e3 SMART
PbH1 783 805 1.86e2 SMART
PbH1 828 850 9.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140008
AA Change: S152T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119862
Gene: ENSMUSG00000048232
AA Change: S152T

DomainStartEndE-ValueType
PbH1 25 44 8.34e3 SMART
PbH1 65 87 1.37e3 SMART
CASH 164 338 7.29e-6 SMART
PbH1 250 271 1.41e2 SMART
PbH1 294 316 1.33e3 SMART
PbH1 317 339 1.32e2 SMART
PbH1 340 362 8.34e3 SMART
PbH1 363 385 2.87e1 SMART
CASH 363 499 5.49e1 SMART
PbH1 386 408 1.25e1 SMART
PbH1 409 431 2.64e2 SMART
PbH1 432 454 6.05e3 SMART
PbH1 455 477 2.46e2 SMART
PbH1 478 500 2.14e2 SMART
CASH 508 631 6.58e1 SMART
PbH1 540 562 6.52e2 SMART
PbH1 563 585 5.92e2 SMART
PbH1 587 609 1.13e3 SMART
PbH1 610 632 1.86e2 SMART
PbH1 655 677 9.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155583
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Fbxo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Fbxo10 APN 4 45058684 missense probably damaging 0.98
IGL02073:Fbxo10 APN 4 45046349 missense possibly damaging 0.94
IGL02097:Fbxo10 APN 4 45048527 missense probably benign 0.24
IGL02315:Fbxo10 APN 4 45062469 missense probably benign 0.08
IGL02403:Fbxo10 APN 4 45062517 missense probably benign 0.01
IGL02408:Fbxo10 APN 4 45058361 missense possibly damaging 0.75
IGL02496:Fbxo10 APN 4 45043883 missense probably damaging 1.00
IGL02583:Fbxo10 APN 4 45044754 missense probably damaging 1.00
IGL02794:Fbxo10 APN 4 45041928 missense probably benign 0.20
N/A - 287:Fbxo10 UTSW 4 45044708 splice site probably benign
R1033:Fbxo10 UTSW 4 45062236 missense probably damaging 1.00
R1102:Fbxo10 UTSW 4 45043672 missense probably damaging 1.00
R1583:Fbxo10 UTSW 4 45062118 missense probably damaging 1.00
R1586:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R1789:Fbxo10 UTSW 4 45046389 missense probably damaging 1.00
R2187:Fbxo10 UTSW 4 45058531 missense probably benign 0.09
R2191:Fbxo10 UTSW 4 45044811 missense probably damaging 1.00
R2377:Fbxo10 UTSW 4 45044719 missense probably benign 0.18
R2425:Fbxo10 UTSW 4 45051642 missense possibly damaging 0.60
R2495:Fbxo10 UTSW 4 45040545 missense probably benign 0.00
R4105:Fbxo10 UTSW 4 45059054 missense probably benign 0.01
R4472:Fbxo10 UTSW 4 45043693 missense probably damaging 1.00
R4480:Fbxo10 UTSW 4 45048470 missense probably damaging 1.00
R4985:Fbxo10 UTSW 4 45040692 missense probably benign 0.33
R5193:Fbxo10 UTSW 4 45051573 nonsense probably null
R5309:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5312:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5348:Fbxo10 UTSW 4 45058934 missense probably damaging 1.00
R5694:Fbxo10 UTSW 4 45035970 missense probably damaging 1.00
R5974:Fbxo10 UTSW 4 45040631 missense probably benign 0.18
R5990:Fbxo10 UTSW 4 45061960 missense probably damaging 1.00
R6197:Fbxo10 UTSW 4 45043857 missense probably benign 0.03
R6359:Fbxo10 UTSW 4 45041796 missense possibly damaging 0.93
R6808:Fbxo10 UTSW 4 45059035 missense probably benign 0.00
R6873:Fbxo10 UTSW 4 45041787 missense possibly damaging 0.94
R6921:Fbxo10 UTSW 4 45044849 missense probably damaging 1.00
R7089:Fbxo10 UTSW 4 45062230 missense possibly damaging 0.90
R7120:Fbxo10 UTSW 4 45040533 nonsense probably null
R7498:Fbxo10 UTSW 4 45062194 missense probably benign 0.04
R7872:Fbxo10 UTSW 4 45051699 missense not run
R8022:Fbxo10 UTSW 4 45062062 missense possibly damaging 0.93
R8161:Fbxo10 UTSW 4 45044793 missense probably damaging 1.00
R8416:Fbxo10 UTSW 4 45058942 missense possibly damaging 0.83
R8419:Fbxo10 UTSW 4 45041809 missense possibly damaging 0.72
R8744:Fbxo10 UTSW 4 45043880 missense probably benign
R8798:Fbxo10 UTSW 4 45051605 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAGTGAATTCAGCACTAGACAGC -3'
(R):5'- GAACTGGGCCTACAAGTACCTG -3'

Sequencing Primer
(F):5'- CTGAATAGATGCTCCAGGTAGC -3'
(R):5'- AAGTACCTGCTGGGCCTTATCAAG -3'
Posted On2016-12-20