Incidental Mutation 'R5844:Hepacam2'
ID450586
Institutional Source Beutler Lab
Gene Symbol Hepacam2
Ensembl Gene ENSMUSG00000044156
Gene NameHEPACAM family member 2
Synonyms
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3457096-3498298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3476073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 284 (I284T)
Ref Sequence ENSEMBL: ENSMUSP00000058882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049985] [ENSMUST00000201607]
Predicted Effect probably damaging
Transcript: ENSMUST00000049985
AA Change: I284T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058882
Gene: ENSMUSG00000044156
AA Change: I284T

DomainStartEndE-ValueType
IG 39 142 7.77e-1 SMART
IGc2 165 227 6.21e-9 SMART
IG 256 334 1.87e0 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000184466
AA Change: I271T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201276
Predicted Effect probably benign
Transcript: ENSMUST00000201607
SMART Domains Protein: ENSMUSP00000143834
Gene: ENSMUSG00000044156

DomainStartEndE-ValueType
IG_like 2 66 1.2e-1 SMART
IGc2 89 151 2.5e-11 SMART
Blast:IG 180 206 9e-11 BLAST
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the immunoglobulin superfamily that plays a role in mitosis. Knockdown of this gene results in prometaphase arrest, abnormal nuclear morphology and apoptosis. Poly(ADP-ribosylation) of the encoded protein promotes its translocation to centrosomes, which may stimulate centrosome maturation. A chromosomal deletion including this gene may be associated with myeloid leukemia and myelodysplastic syndrome in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Hepacam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL01945:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL02254:Hepacam2 APN 6 3483421 missense probably benign 0.06
IGL02445:Hepacam2 APN 6 3483481 missense probably damaging 1.00
IGL02546:Hepacam2 APN 6 3483568 missense possibly damaging 0.93
IGL02620:Hepacam2 APN 6 3487280 splice site probably benign
IGL02697:Hepacam2 APN 6 3476036 missense possibly damaging 0.79
R0089:Hepacam2 UTSW 6 3487094 missense probably damaging 0.96
R0208:Hepacam2 UTSW 6 3467505 splice site probably benign
R0230:Hepacam2 UTSW 6 3463336 missense probably benign 0.01
R0299:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0499:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0608:Hepacam2 UTSW 6 3483479 missense possibly damaging 0.93
R1350:Hepacam2 UTSW 6 3467530 nonsense probably null
R1663:Hepacam2 UTSW 6 3483439 missense possibly damaging 0.76
R1749:Hepacam2 UTSW 6 3483379 missense probably damaging 1.00
R1997:Hepacam2 UTSW 6 3487241 missense probably damaging 1.00
R2146:Hepacam2 UTSW 6 3463378 splice site probably benign
R3911:Hepacam2 UTSW 6 3494477 start codon destroyed probably null 0.98
R4281:Hepacam2 UTSW 6 3475938 missense probably damaging 0.98
R4290:Hepacam2 UTSW 6 3487237 missense probably benign 0.01
R4371:Hepacam2 UTSW 6 3486988 missense probably damaging 1.00
R4794:Hepacam2 UTSW 6 3475933 missense probably damaging 0.96
R4890:Hepacam2 UTSW 6 3487231 missense probably damaging 0.96
R5330:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5331:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5677:Hepacam2 UTSW 6 3466142 missense probably damaging 1.00
R5796:Hepacam2 UTSW 6 3466200 unclassified probably null
R5979:Hepacam2 UTSW 6 3476149 missense probably damaging 1.00
R6017:Hepacam2 UTSW 6 3483332 missense probably damaging 1.00
R7460:Hepacam2 UTSW 6 3487199 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCACACTTACCTACGGAAGTTATG -3'
(R):5'- AGACCAGGCTCTTTAAACCCTG -3'

Sequencing Primer
(F):5'- ACCTACGGAAGTTATGATGACTGTG -3'
(R):5'- CAGGCTCTTTAAACCCTGAAACTGTG -3'
Posted On2016-12-20