Incidental Mutation 'R0550:St6galnac4'
ID 45060
Institutional Source Beutler Lab
Gene Symbol St6galnac4
Ensembl Gene ENSMUSG00000079442
Gene Name ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Synonyms Siat7d, ST6GalNAc IV
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0550 (G1)
Quality Score 170
Status Validated
Chromosome 2
Chromosomal Location 32477107-32489710 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 32484031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 76 (C76*)
Ref Sequence ENSEMBL: ENSMUSP00000136093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102818] [ENSMUST00000179989]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000102818
AA Change: C76*
SMART Domains Protein: ENSMUSP00000099882
Gene: ENSMUSG00000079442
AA Change: C76*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 48 296 4.5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123080
Predicted Effect probably benign
Transcript: ENSMUST00000146557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175406
Predicted Effect probably null
Transcript: ENSMUST00000179989
AA Change: C76*
SMART Domains Protein: ENSMUSP00000136093
Gene: ENSMUSG00000079442
AA Change: C76*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 46 296 1.7e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192934
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein prefers glycoproteins rather than glycolipids as substrates and shows restricted substrate specificity, utilizing only the trisaccharide sequence Neu5Ac-alpha-2,3-Gal-beta-1,3-GalNAc. In addition, it is involved in the synthesis of ganglioside GD1A from GM1B. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in St6galnac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:St6galnac4 APN 2 32,484,098 (GRCm39) missense probably damaging 1.00
IGL02615:St6galnac4 APN 2 32,484,216 (GRCm39) missense probably benign 0.33
IGL02742:St6galnac4 APN 2 32,487,096 (GRCm39) missense possibly damaging 0.46
paxinterra UTSW 2 32,484,111 (GRCm39) missense probably damaging 1.00
warcraft UTSW 2 32,484,075 (GRCm39) missense probably damaging 1.00
R0454:St6galnac4 UTSW 2 32,484,330 (GRCm39) missense probably damaging 1.00
R0647:St6galnac4 UTSW 2 32,479,460 (GRCm39) missense probably damaging 0.96
R3419:St6galnac4 UTSW 2 32,485,743 (GRCm39) missense probably damaging 1.00
R4682:St6galnac4 UTSW 2 32,484,111 (GRCm39) missense probably damaging 1.00
R4700:St6galnac4 UTSW 2 32,477,172 (GRCm39) unclassified probably benign
R4995:St6galnac4 UTSW 2 32,484,075 (GRCm39) missense probably damaging 1.00
R6538:St6galnac4 UTSW 2 32,487,090 (GRCm39) missense possibly damaging 0.47
R8273:St6galnac4 UTSW 2 32,477,667 (GRCm39) start gained probably benign
R8391:St6galnac4 UTSW 2 32,484,086 (GRCm39) missense probably damaging 1.00
R8887:St6galnac4 UTSW 2 32,484,110 (GRCm39) missense probably damaging 1.00
R9388:St6galnac4 UTSW 2 32,479,625 (GRCm39) missense probably damaging 1.00
R9507:St6galnac4 UTSW 2 32,485,739 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGACTGATCCAGCTATCAGACAG -3'
(R):5'- AGGCCATCATGCGTTCAGTGAAG -3'

Sequencing Primer
(F):5'- TCCAGCTATCAGACAGATTAGTGG -3'
(R):5'- TGCAGCAACGTTCGGTAG -3'
Posted On 2013-06-11