Incidental Mutation 'R0550:Kif5c'
ID 45061
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Name kinesin family member 5C
Synonyms Khc
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0550 (G1)
Quality Score 212
Status Validated
Chromosome 2
Chromosomal Location 49509310-49664790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49648924 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 956 (K956R)
Ref Sequence ENSEMBL: ENSMUSP00000028102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102]
AlphaFold P28738
PDB Structure Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-AlFx [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-VO4 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028102
AA Change: K956R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: K956R

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132968
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49,584,828 (GRCm39) missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49,591,089 (GRCm39) missense probably damaging 1.00
IGL01459:Kif5c APN 2 49,625,569 (GRCm39) missense probably benign 0.36
IGL02127:Kif5c APN 2 49,591,122 (GRCm39) splice site probably null
IGL03088:Kif5c APN 2 49,634,455 (GRCm39) missense probably benign 0.01
IGL03379:Kif5c APN 2 49,591,104 (GRCm39) missense probably damaging 0.97
IGL02988:Kif5c UTSW 2 49,509,729 (GRCm39) missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49,584,044 (GRCm39) missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49,631,360 (GRCm39) missense probably benign 0.00
R0017:Kif5c UTSW 2 49,622,725 (GRCm39) missense probably benign
R0017:Kif5c UTSW 2 49,622,725 (GRCm39) missense probably benign
R0116:Kif5c UTSW 2 49,642,251 (GRCm39) splice site probably benign
R0760:Kif5c UTSW 2 49,578,765 (GRCm39) missense probably damaging 1.00
R0967:Kif5c UTSW 2 49,588,128 (GRCm39) unclassified probably benign
R1015:Kif5c UTSW 2 49,634,377 (GRCm39) missense probably benign 0.13
R1758:Kif5c UTSW 2 49,613,145 (GRCm39) missense probably benign 0.00
R1786:Kif5c UTSW 2 49,648,817 (GRCm39) splice site probably benign
R1828:Kif5c UTSW 2 49,570,252 (GRCm39) critical splice donor site probably null
R2130:Kif5c UTSW 2 49,648,817 (GRCm39) splice site probably benign
R2132:Kif5c UTSW 2 49,648,817 (GRCm39) splice site probably benign
R2237:Kif5c UTSW 2 49,584,020 (GRCm39) missense probably benign 0.35
R3970:Kif5c UTSW 2 49,578,756 (GRCm39) missense probably damaging 1.00
R4439:Kif5c UTSW 2 49,578,737 (GRCm39) missense possibly damaging 0.90
R5260:Kif5c UTSW 2 49,625,602 (GRCm39) missense probably damaging 0.99
R5318:Kif5c UTSW 2 49,561,840 (GRCm39) missense probably benign
R5345:Kif5c UTSW 2 49,613,078 (GRCm39) missense probably benign
R5490:Kif5c UTSW 2 49,648,870 (GRCm39) missense probably benign
R5496:Kif5c UTSW 2 49,620,202 (GRCm39) missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49,620,211 (GRCm39) missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49,620,211 (GRCm39) missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49,625,521 (GRCm39) missense probably benign 0.09
R6688:Kif5c UTSW 2 49,578,749 (GRCm39) missense probably benign 0.06
R7006:Kif5c UTSW 2 49,625,526 (GRCm39) missense probably damaging 0.97
R7009:Kif5c UTSW 2 49,647,441 (GRCm39) missense probably benign
R7081:Kif5c UTSW 2 49,631,373 (GRCm39) missense probably benign 0.00
R7372:Kif5c UTSW 2 49,648,671 (GRCm39) splice site probably null
R7512:Kif5c UTSW 2 49,590,977 (GRCm39) missense probably damaging 1.00
R7549:Kif5c UTSW 2 49,591,105 (GRCm39) missense probably benign 0.11
R7764:Kif5c UTSW 2 49,639,339 (GRCm39) missense probably damaging 1.00
R7764:Kif5c UTSW 2 49,617,973 (GRCm39) critical splice donor site probably null
R7904:Kif5c UTSW 2 49,591,095 (GRCm39) missense probably damaging 1.00
R8292:Kif5c UTSW 2 49,625,497 (GRCm39) missense probably benign 0.05
R8735:Kif5c UTSW 2 49,584,783 (GRCm39) missense probably damaging 1.00
R8816:Kif5c UTSW 2 49,584,799 (GRCm39) missense probably damaging 1.00
R9109:Kif5c UTSW 2 49,620,151 (GRCm39) missense probably damaging 1.00
R9139:Kif5c UTSW 2 49,620,291 (GRCm39) missense probably benign 0.00
R9257:Kif5c UTSW 2 49,590,604 (GRCm39) nonsense probably null
R9325:Kif5c UTSW 2 49,639,378 (GRCm39) missense probably benign 0.04
R9368:Kif5c UTSW 2 49,622,792 (GRCm39) missense probably damaging 0.99
R9748:Kif5c UTSW 2 49,584,859 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGAGGCCAGACCTGCTATGC -3'
(R):5'- TGGCAAAGCTAGGCCCAGATTTC -3'

Sequencing Primer
(F):5'- ACCTGCTATGCCCAGGAAG -3'
(R):5'- AAAGCTAGGCCCAGATTTCTCTTAC -3'
Posted On 2013-06-11