Incidental Mutation 'R5844:Adra1a'
ID450612
Institutional Source Beutler Lab
Gene Symbol Adra1a
Ensembl Gene ENSMUSG00000045875
Gene Nameadrenergic receptor, alpha 1a
SynonymsAdra1c
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66635251-66771168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66727734 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 391 (T391I)
Ref Sequence ENSEMBL: ENSMUSP00000124322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054661] [ENSMUST00000159068] [ENSMUST00000159365] [ENSMUST00000161339] [ENSMUST00000225182]
Predicted Effect probably benign
Transcript: ENSMUST00000054661
AA Change: T391I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053703
Gene: ENSMUSG00000045875
AA Change: T391I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 1.7e-80 PFAM
Pfam:7TM_GPCR_Srv 44 343 4.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159068
AA Change: T391I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124570
Gene: ENSMUSG00000045875
AA Change: T391I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159365
AA Change: T391I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124322
Gene: ENSMUSG00000045875
AA Change: T391I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 1.7e-17 PFAM
Pfam:7tm_1 43 326 1.8e-83 PFAM
Pfam:7TM_GPCR_Srv 44 343 7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161339
AA Change: T391I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125354
Gene: ENSMUSG00000045875
AA Change: T391I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225182
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes one of several multipass transmembrane proteins that function as G protein-coupled receptors. The encoded protein binds to epinephrine and norepinephrine to mediate signaling in cells of the cardiac, nervous, and other organ systems. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mutations in this gene result in hypotension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Adra1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Adra1a APN 14 66637873 missense probably damaging 1.00
IGL02751:Adra1a APN 14 66727532 missense possibly damaging 0.76
IGL02755:Adra1a APN 14 66727661 missense probably benign
IGL03367:Adra1a APN 14 66637989 missense possibly damaging 0.89
R0610:Adra1a UTSW 14 66637792 missense probably damaging 1.00
R0840:Adra1a UTSW 14 66727710 missense possibly damaging 0.73
R1720:Adra1a UTSW 14 66638278 missense probably damaging 1.00
R1902:Adra1a UTSW 14 66638235 missense probably benign 0.30
R2131:Adra1a UTSW 14 66727532 missense possibly damaging 0.76
R2198:Adra1a UTSW 14 66637936 missense probably damaging 1.00
R4702:Adra1a UTSW 14 66637559 start gained probably benign
R4761:Adra1a UTSW 14 66727431 splice site probably null
R4784:Adra1a UTSW 14 66637824 missense probably damaging 1.00
R4814:Adra1a UTSW 14 66638032 missense probably benign 0.01
R7346:Adra1a UTSW 14 66638284 missense probably benign 0.16
R7508:Adra1a UTSW 14 66637935 missense probably damaging 1.00
Z1088:Adra1a UTSW 14 66727496 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGCCAGGAGTTCAAGAAAG -3'
(R):5'- TTTCACCGAGGGAGATGGTG -3'

Sequencing Primer
(F):5'- GAAAGCCTTTCAGAATGTGCTGC -3'
(R):5'- CCGAGGGAGATGGTGTGGATC -3'
Posted On2016-12-20