Incidental Mutation 'R5844:Dagla'
ID450617
Institutional Source Beutler Lab
Gene Symbol Dagla
Ensembl Gene ENSMUSG00000035735
Gene Namediacylglycerol lipase, alpha
SynonymsNsddr
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10245265-10304877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10271125 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 57 (D57V)
Ref Sequence ENSEMBL: ENSMUSP00000138702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039327] [ENSMUST00000125567]
Predicted Effect probably damaging
Transcript: ENSMUST00000039327
AA Change: D57V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046358
Gene: ENSMUSG00000035735
AA Change: D57V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Pfam:Lipase_3 394 533 1.3e-12 PFAM
low complexity region 616 625 N/A INTRINSIC
low complexity region 699 717 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
low complexity region 980 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125567
AA Change: D57V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138702
Gene: ENSMUSG00000035735
AA Change: D57V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
Meta Mutation Damage Score 0.2607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a diacylglycerol lipase. The encoded enzyme is involved in the biosynthesis of the endocannabinoid 2-arachidonoyl-glycerol.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for null mutations have decreased body weight, adult neuronal proliferation, and nervous system endocannaboid levels and abnormal inhibitory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Dagla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Dagla APN 19 10248520 missense possibly damaging 0.51
IGL01625:Dagla APN 19 10251202 splice site probably benign
IGL01697:Dagla APN 19 10271198 missense probably benign 0.01
IGL01940:Dagla APN 19 10252171 missense probably benign
IGL02330:Dagla APN 19 10248022 missense probably damaging 1.00
PIT4480001:Dagla UTSW 19 10260658 missense probably benign 0.02
R0541:Dagla UTSW 19 10254806 critical splice donor site probably null
R0610:Dagla UTSW 19 10271558 missense probably damaging 1.00
R0638:Dagla UTSW 19 10254883 missense probably damaging 0.97
R0653:Dagla UTSW 19 10248425 missense probably damaging 1.00
R1675:Dagla UTSW 19 10269323 missense probably benign 0.00
R1822:Dagla UTSW 19 10263186 missense possibly damaging 0.94
R1830:Dagla UTSW 19 10271014 missense probably benign 0.44
R2303:Dagla UTSW 19 10252103 missense probably damaging 1.00
R2568:Dagla UTSW 19 10248152 missense probably benign
R2879:Dagla UTSW 19 10271084 missense possibly damaging 0.93
R2902:Dagla UTSW 19 10248103 missense probably damaging 0.99
R2939:Dagla UTSW 19 10256364 missense probably damaging 1.00
R3771:Dagla UTSW 19 10248467 missense possibly damaging 0.89
R4176:Dagla UTSW 19 10263097 missense probably damaging 1.00
R4255:Dagla UTSW 19 10256952 nonsense probably null
R4519:Dagla UTSW 19 10269732 missense probably damaging 1.00
R4584:Dagla UTSW 19 10271009 missense probably damaging 1.00
R4586:Dagla UTSW 19 10271009 missense probably damaging 1.00
R4614:Dagla UTSW 19 10248277 missense probably damaging 1.00
R4751:Dagla UTSW 19 10250394 missense probably benign 0.00
R4933:Dagla UTSW 19 10269715 critical splice donor site probably null
R5858:Dagla UTSW 19 10254968 intron probably benign
R5958:Dagla UTSW 19 10248424 missense probably damaging 1.00
R6628:Dagla UTSW 19 10263227 missense probably damaging 1.00
R6799:Dagla UTSW 19 10256850 missense probably damaging 1.00
R7072:Dagla UTSW 19 10256295 critical splice donor site probably null
R7253:Dagla UTSW 19 10262581 splice site probably null
R7451:Dagla UTSW 19 10253355 missense probably damaging 1.00
R7654:Dagla UTSW 19 10248206 missense probably benign 0.01
X0021:Dagla UTSW 19 10271164 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGGGCTGACTCAGTTTG -3'
(R):5'- AGTCGGGCACATCTTGTTG -3'

Sequencing Primer
(F):5'- CTGACTCAGTTTGTGTTTGTAACC -3'
(R):5'- CACATCTTGTTGGGGGAGATATC -3'
Posted On2016-12-20