Mutagenetix > Incidental Mutations

Incidental Mutation 'R5123:Hjurp'

450619

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

MMRRC Submission

042711-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.896) question?

Stock #

R5123 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88275050 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 71 (Y71N)

Ref Sequence

ENSEMBL: ENSMUSP00000070419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000065420] [ENSMUST00000147393]

Predicted Effect

probably benign
Transcript: ENSMUST00000054674
AA Change: Y71N

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783
AA Change: Y71N

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065420
AA Change: Y71N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783
AA Change: Y71N

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126739

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393
AA Change: Y71N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783
AA Change: Y71N

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148138

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148384

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (53/54)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	G	A	17: 24,384,460	G542D	possibly damaging	Het
Adh6b	A	G	3: 138,357,689	Y343C	probably damaging	Het
Adsl	T	A	15: 80,952,294		probably null	Het
Apob	T	A	12: 8,007,630		probably null	Het
Atp6ap1l	T	A	13: 90,898,898		probably benign	Het
Cacnb3	A	G	15: 98,639,869	D74G	probably damaging	Het
Clca3a2	T	A	3: 144,806,343	D544V	probably damaging	Het
Col3a1	G	A	1: 45,333,596		probably benign	Het
D7Ertd443e	A	G	7: 134,349,668		probably null	Het
Dscam	T	C	16: 96,772,437	D775G	probably damaging	Het
Eif2b3	T	A	4: 117,022,211	M16K	probably damaging	Het
Eml5	T	C	12: 98,874,512	Y281C	probably damaging	Het
Epha2	T	A	4: 141,308,865	L204Q	possibly damaging	Het
Filip1l	A	C	16: 57,570,662	I538L	possibly damaging	Het
Gcnt2	T	A	13: 40,918,355	V158D	probably damaging	Het
Gnaq	A	G	19: 16,332,085	N162S	probably benign	Het
Haus5	A	T	7: 30,654,226	N575K	probably benign	Het
Igsf5	A	G	16: 96,373,079	D103G	probably damaging	Het
Myo10	A	G	15: 25,726,483	D297G	possibly damaging	Het
Net1	C	T	13: 3,886,623	R314H	probably damaging	Het
Olfr1273-ps	C	A	2: 90,296,168	R231L	probably benign	Het
Olfr1301	T	A	2: 111,754,552	V101D	probably damaging	Het
Pcsk4	C	A	10: 80,322,145	Q586H	probably null	Het
Pramef6	A	T	4: 143,897,136	M156K	probably benign	Het
Prss1	A	G	6: 41,463,197	D156G	possibly damaging	Het
Rnf133	A	T	6: 23,649,260	N266K	probably damaging	Het
Setd2	G	T	9: 110,617,527	A2482S	possibly damaging	Het
Sgo2a	A	T	1: 58,016,567	S637C	probably damaging	Het
Slc2a5	C	A	4: 150,139,805	S290*	probably null	Het
Spata6	T	G	4: 111,768,795	H120Q	possibly damaging	Het
Stk11	G	A	10: 80,127,941	V194I	probably damaging	Het
Tkt	T	C	14: 30,565,646	V199A	probably benign	Het
Traf3	G	A	12: 111,243,518	V183M	possibly damaging	Het
Trappc11	T	C	8: 47,513,402	Y483C	probably damaging	Het
Trappc9	T	C	15: 72,913,366		probably benign	Het
Trim59	T	C	3: 69,037,734	H91R	probably benign	Het
Ttc21a	A	G	9: 119,952,212	S484G	probably benign	Het
Usp13	A	T	3: 32,915,798	H691L	probably benign	Het
Vmn1r238	T	C	18: 3,123,243	Y57C	probably benign	Het
Vmn2r111	T	A	17: 22,571,143	Q294L	possibly damaging	Het
Vmn2r17	A	G	5: 109,427,908	D215G	possibly damaging	Het
Wdr66	A	G	5: 123,273,633		probably benign	Het
Zfp280b	A	G	10: 76,039,349	D354G	probably benign	Het
Zfp607a	A	G	7: 27,879,098	H531R	probably damaging	Het
Zfp74	A	T	7: 29,934,733	C517S	probably damaging	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03147:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1333:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
R1342:Hjurp	UTSW	1	88277368	splice site	probably benign
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1637:Hjurp	UTSW	1	88266121	missense	probably benign	0.03
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2024:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5318:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTACACATGGCTTGCTGTG -3'
(R):5'- TGGATTGCTCTGAACGCTTGC -3'

Sequencing Primer
(F):5'- CACATGGCTTGCTGTGGACTATG -3'
(R):5'- GAACGCTTGCTTGCCTTTCG -3'

Posted On

2016-12-21