Incidental Mutation 'R5039:Tnfrsf1a'
ID450620
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1a
Ensembl Gene ENSMUSG00000030341
Gene Nametumor necrosis factor receptor superfamily, member 1a
SynonymsCD120a, TNFalpha-R1, TNF-R1, p55-R, TNF receptor alpha chain, TNF-R55, TNFRI, TNFRp55, TNFAR, TNFR60, TNF-R-I, Tnfr1, p55, TNF-alpha-R1, TNF-alphaR1
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125349362-125362484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125360712 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000117470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000042647] [ENSMUST00000130257] [ENSMUST00000144524]
Predicted Effect probably benign
Transcript: ENSMUST00000032491
AA Change: T211A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341
AA Change: T211A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042647
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125880
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130257
SMART Domains Protein: ENSMUSP00000115991
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TNFR_c6 44 66 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134803
Predicted Effect possibly damaging
Transcript: ENSMUST00000144524
AA Change: T89A

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341
AA Change: T89A

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Meta Mutation Damage Score 0.3756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mice lacking a functional copy of this gene exhibit impaired immune function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted splenic architecture, increased adult liver weights, reduced IgG immune response, deficits in some host defense and inflammatory responses, LPS resistance, and reduced graft-vs-host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Tnfrsf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Tnfrsf1a APN 6 125356864 missense probably damaging 1.00
IGL02468:Tnfrsf1a APN 6 125357861 missense probably benign 0.06
IGL02588:Tnfrsf1a APN 6 125360766 missense probably benign 0.44
R1302:Tnfrsf1a UTSW 6 125356916 missense probably damaging 1.00
R2189:Tnfrsf1a UTSW 6 125357805 missense probably benign 0.42
R4559:Tnfrsf1a UTSW 6 125360766 missense probably benign 0.44
R4794:Tnfrsf1a UTSW 6 125358084 missense probably damaging 1.00
R5364:Tnfrsf1a UTSW 6 125357393 missense possibly damaging 0.87
R5792:Tnfrsf1a UTSW 6 125358077 missense probably damaging 1.00
R6742:Tnfrsf1a UTSW 6 125356948 missense probably damaging 0.99
R7018:Tnfrsf1a UTSW 6 125356951 missense probably damaging 1.00
R7128:Tnfrsf1a UTSW 6 125361536 missense probably benign 0.11
R7192:Tnfrsf1a UTSW 6 125361596 missense unknown
R7715:Tnfrsf1a UTSW 6 125361414 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACCTCCTCCGCTTGCAAATG -3'
(R):5'- AGCCTAGAGTCCTTAACCATGAAG -3'

Sequencing Primer
(F):5'- TCCGCTTGCAAATGTCACAAAC -3'
(R):5'- GTCCTTAACCATGAAGAGAGGCC -3'
Posted On2016-12-27