Incidental Mutation 'R5036:Taok1'
ID450624
Institutional Source Beutler Lab
Gene Symbol Taok1
Ensembl Gene ENSMUSG00000017291
Gene NameTAO kinase 1
SynonymsD130018F14Rik, 2810468K05Rik
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R5036 (G1)
Quality Score61
Status Validated
Chromosome11
Chromosomal Location77529162-77607815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77549331 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 617 (R617C)
Ref Sequence ENSEMBL: ENSMUSP00000055470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017435] [ENSMUST00000058496]
Predicted Effect probably benign
Transcript: ENSMUST00000017435
AA Change: R617C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000017435
Gene: ENSMUSG00000017291
AA Change: R617C

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058496
AA Change: R617C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000055470
Gene: ENSMUSG00000017291
AA Change: R617C

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Meta Mutation Damage Score 0.2043 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Taok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Taok1 APN 11 77571684 missense probably damaging 1.00
IGL01629:Taok1 APN 11 77538204 missense possibly damaging 0.63
IGL02198:Taok1 APN 11 77575677 splice site probably benign
IGL02392:Taok1 APN 11 77549352 missense probably benign 0.13
IGL02415:Taok1 APN 11 77540240 unclassified probably benign
IGL02428:Taok1 APN 11 77549277 missense probably benign 0.01
IGL02972:Taok1 APN 11 77559758 missense probably benign 0.04
IGL03200:Taok1 APN 11 77575652 nonsense probably null
IGL03203:Taok1 APN 11 77540085 missense probably damaging 0.96
IGL03292:Taok1 APN 11 77540136 missense probably benign 0.07
IGL03351:Taok1 APN 11 77560328 missense probably damaging 0.96
R0070:Taok1 UTSW 11 77553717 missense probably benign
R0497:Taok1 UTSW 11 77573804 missense probably damaging 0.97
R0535:Taok1 UTSW 11 77553704 missense probably benign 0.00
R0558:Taok1 UTSW 11 77559844 missense possibly damaging 0.89
R0653:Taok1 UTSW 11 77578724 critical splice donor site probably null
R1249:Taok1 UTSW 11 77571637 missense probably damaging 1.00
R1424:Taok1 UTSW 11 77549364 missense probably benign 0.00
R1597:Taok1 UTSW 11 77579800 missense probably benign 0.31
R2112:Taok1 UTSW 11 77571646 missense probably benign 0.01
R3716:Taok1 UTSW 11 77541810 missense probably benign 0.09
R4013:Taok1 UTSW 11 77559833 missense possibly damaging 0.95
R4058:Taok1 UTSW 11 77549438 missense probably benign 0.05
R4831:Taok1 UTSW 11 77553674 missense probably null 0.34
R5917:Taok1 UTSW 11 77560318 missense probably damaging 0.99
R6271:Taok1 UTSW 11 77573783 missense probably damaging 1.00
R6286:Taok1 UTSW 11 77553773 missense probably benign 0.00
R6860:Taok1 UTSW 11 77541801 missense probably benign 0.01
R6933:Taok1 UTSW 11 77555653 missense probably benign
R7139:Taok1 UTSW 11 77571633 missense probably damaging 1.00
R7143:Taok1 UTSW 11 77537988 missense probably benign
R7305:Taok1 UTSW 11 77541674 nonsense probably null
R7340:Taok1 UTSW 11 77579817 missense possibly damaging 0.89
R7508:Taok1 UTSW 11 77545326 missense probably damaging 0.97
R7569:Taok1 UTSW 11 77555614 missense probably benign 0.06
R7753:Taok1 UTSW 11 77537899 missense probably benign 0.29
R8064:Taok1 UTSW 11 77549304 nonsense probably null
Z1176:Taok1 UTSW 11 77559926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAGGCCAGAAGGATTTACAG -3'
(R):5'- CATGCAGGGAACATATTACTTACC -3'

Sequencing Primer
(F):5'- GATTTACAGAGTAAGGCATTGCTG -3'
(R):5'- GCAGGGAACATATTACTTACCTTTTC -3'
Posted On2016-12-27