Incidental Mutation 'R5056:Foxj2'
ID450628
Institutional Source Beutler Lab
Gene Symbol Foxj2
Ensembl Gene ENSMUSG00000003154
Gene Nameforkhead box J2
SynonymsFhx
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R5056 (G1)
Quality Score214
Status Validated
Chromosome6
Chromosomal Location122819914-122845366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122833874 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 271 (H271R)
Ref Sequence ENSEMBL: ENSMUSP00000137645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000177927] [ENSMUST00000203075]
Predicted Effect probably benign
Transcript: ENSMUST00000003238
AA Change: H271R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154
AA Change: H271R

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177927
AA Change: H271R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154
AA Change: H271R

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196252
Predicted Effect probably benign
Transcript: ENSMUST00000203075
SMART Domains Protein: ENSMUSP00000145438
Gene: ENSMUSG00000003154

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 7.8e-50 SMART
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Foxj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Foxj2 APN 6 122839635 missense probably damaging 1.00
IGL01100:Foxj2 APN 6 122828391 missense probably damaging 1.00
IGL02169:Foxj2 APN 6 122828466 missense probably damaging 0.98
IGL02220:Foxj2 APN 6 122838581 splice site probably benign
IGL02423:Foxj2 APN 6 122842773 missense possibly damaging 0.90
IGL03026:Foxj2 APN 6 122838180 missense probably benign 0.38
IGL03198:Foxj2 APN 6 122833007 critical splice donor site probably null
R0400:Foxj2 UTSW 6 122833808 missense possibly damaging 0.69
R1572:Foxj2 UTSW 6 122833261 missense probably benign 0.00
R2063:Foxj2 UTSW 6 122840241 missense probably benign 0.01
R2568:Foxj2 UTSW 6 122828372 missense probably damaging 1.00
R2877:Foxj2 UTSW 6 122842832 missense probably damaging 0.96
R4745:Foxj2 UTSW 6 122837989 missense probably damaging 1.00
R4763:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4764:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4765:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4775:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R5816:Foxj2 UTSW 6 122833736 missense probably benign
R6254:Foxj2 UTSW 6 122838139 missense probably damaging 0.98
R6265:Foxj2 UTSW 6 122828174 missense probably damaging 0.99
R6540:Foxj2 UTSW 6 122833243 missense probably benign
R6882:Foxj2 UTSW 6 122828505 critical splice donor site probably null
R6981:Foxj2 UTSW 6 122828444 missense probably damaging 1.00
R6981:Foxj2 UTSW 6 122842839 missense probably benign 0.14
R7295:Foxj2 UTSW 6 122840231 missense probably benign 0.14
R7475:Foxj2 UTSW 6 122837842 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGGCTTAGGTCACCGTTCTTAC -3'
(R):5'- GAAGAGAACATTACCACTTGACAG -3'

Sequencing Primer
(F):5'- TGTCTTTGCAGGGCCCAG -3'
(R):5'- GTATAAGAAACTTTCAGTCCCAGC -3'
Posted On2016-12-27