Incidental Mutation 'R0550:Olfr1065'
ID45063
Institutional Source Beutler Lab
Gene Symbol Olfr1065
Ensembl Gene ENSMUSG00000111306
Gene Nameolfactory receptor 1065
SynonymsMOR190-1, GA_x6K02T2Q125-47915274-47914333
MMRRC Submission 038742-MU
Accession Numbers

Genbank: NM_146408; MGI: 3030899

Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R0550 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86443958-86450591 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86445876 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 35 (Y35*)
Ref Sequence ENSEMBL: ENSMUSP00000149248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000216165] [ENSMUST00000217586]
Predicted Effect probably null
Transcript: ENSMUST00000099886
AA Change: Y35*
SMART Domains Protein: ENSMUSP00000097471
Gene: ENSMUSG00000075182
AA Change: Y35*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.1e-53 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213789
AA Change: Y35*
Predicted Effect probably null
Transcript: ENSMUST00000216162
AA Change: Y35*
Predicted Effect probably null
Transcript: ENSMUST00000216165
AA Change: Y35*
Predicted Effect probably null
Transcript: ENSMUST00000217586
AA Change: Y35*
Meta Mutation Damage Score 0.9715 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Olfr1065
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03133:Olfr1065 APN 2 86445658 missense probably damaging 0.99
IGL03173:Olfr1065 APN 2 86445444 nonsense probably null
IGL03257:Olfr1065 APN 2 86445890 missense probably damaging 0.98
D4043:Olfr1065 UTSW 2 86445220 missense probably damaging 0.99
R0265:Olfr1065 UTSW 2 86445959 missense probably benign 0.00
R0633:Olfr1065 UTSW 2 86445129 missense probably benign 0.45
R0727:Olfr1065 UTSW 2 86445938 missense probably benign 0.00
R1017:Olfr1065 UTSW 2 86445428 missense probably benign 0.13
R1416:Olfr1065 UTSW 2 86445320 missense probably benign 0.43
R1657:Olfr1065 UTSW 2 86445218 missense probably damaging 1.00
R1983:Olfr1065 UTSW 2 86445076 missense probably benign 0.01
R3919:Olfr1065 UTSW 2 86445418 missense probably benign 0.01
R4345:Olfr1065 UTSW 2 86445845 missense probably damaging 1.00
R5382:Olfr1065 UTSW 2 86445316 missense probably damaging 0.99
R5757:Olfr1065 UTSW 2 86445578 missense probably benign 0.22
R6530:Olfr1065 UTSW 2 86445482 missense probably benign 0.31
R6765:Olfr1065 UTSW 2 86445236 missense probably benign 0.04
R6856:Olfr1065 UTSW 2 86445907 missense probably benign 0.04
R7156:Olfr1065 UTSW 2 86445308 missense probably damaging 1.00
R8239:Olfr1065 UTSW 2 86445129 missense noncoding transcript
R8338:Olfr1065 UTSW 2 86445385 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTAACTGTGTAGCACAAAGGTT -3'
(R):5'- CTTAGCTGTTCTTACAGCACAGGAAGT -3'

Sequencing Primer
(F):5'- CTGTGTAGCACAAAGGTTAAAGG -3'
(R):5'- CACCAAACATTAGGAGCAAGTGTG -3'
Posted On2013-06-11