Incidental Mutation 'R5056:Prdm9'
ID450632
Institutional Source Beutler Lab
Gene Symbol Prdm9
Ensembl Gene ENSMUSG00000051977
Gene NamePR domain containing 9
SynonymsDsbc1, repro7, Rcr1, Meisetz, G1-419-29
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15543079-15564354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15562417 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 104 (Q104R)
Ref Sequence ENSEMBL: ENSMUSP00000131871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147532] [ENSMUST00000167994]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139911
Predicted Effect probably benign
Transcript: ENSMUST00000147532
SMART Domains Protein: ENSMUSP00000118454
Gene: ENSMUSG00000051977

DomainStartEndE-ValueType
Pfam:SSXRD 49 81 1.8e-19 PFAM
SET 123 243 2.56e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167994
AA Change: Q104R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977
AA Change: Q104R

DomainStartEndE-ValueType
KRAB 30 89 5.54e-8 SMART
Pfam:SSXRD 175 205 1.5e-20 PFAM
SET 248 368 2.56e-2 SMART
ZnF_C2H2 392 415 3.29e-1 SMART
ZnF_C2H2 516 535 4.74e1 SMART
ZnF_C2H2 541 563 9.73e-4 SMART
ZnF_C2H2 569 591 1.3e-4 SMART
ZnF_C2H2 597 619 1.3e-4 SMART
ZnF_C2H2 625 647 4.24e-4 SMART
ZnF_C2H2 653 675 4.24e-4 SMART
ZnF_C2H2 681 703 1.95e-3 SMART
ZnF_C2H2 709 731 5.99e-4 SMART
ZnF_C2H2 737 759 1.95e-3 SMART
ZnF_C2H2 765 787 1.95e-3 SMART
ZnF_C2H2 793 815 1.3e-4 SMART
ZnF_C2H2 821 843 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178455
SMART Domains Protein: ENSMUSP00000137164
Gene: ENSMUSG00000095920

DomainStartEndE-ValueType
Pfam:Ribosomal_S21 11 50 1.4e-13 PFAM
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Prdm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Prdm9 APN 17 15553346 missense probably benign 0.11
IGL02322:Prdm9 APN 17 15562848 missense probably damaging 0.99
IGL02354:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02361:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02724:Prdm9 APN 17 15563260 missense probably benign 0.07
IGL03120:Prdm9 APN 17 15544931 missense probably benign
berlin UTSW 17 15562440 missense probably damaging 0.96
R0173:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R0173:Prdm9 UTSW 17 15544035 missense probably benign 0.00
R0309:Prdm9 UTSW 17 15557384 missense probably damaging 0.98
R1420:Prdm9 UTSW 17 15544376 missense probably damaging 1.00
R3498:Prdm9 UTSW 17 15562945 splice site probably benign
R3714:Prdm9 UTSW 17 15557361 nonsense probably null
R4118:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R4369:Prdm9 UTSW 17 15544446 missense probably benign 0.14
R4691:Prdm9 UTSW 17 15553378 missense probably benign 0.03
R4742:Prdm9 UTSW 17 15553521 missense probably damaging 0.99
R4910:Prdm9 UTSW 17 15544323 missense probably benign 0.08
R5130:Prdm9 UTSW 17 15544467 missense probably benign 0.00
R5175:Prdm9 UTSW 17 15557451 missense probably benign 0.04
R5187:Prdm9 UTSW 17 15562893 missense probably damaging 0.98
R5213:Prdm9 UTSW 17 15555154 missense probably damaging 0.98
R5270:Prdm9 UTSW 17 15553363 missense probably benign 0.16
R5635:Prdm9 UTSW 17 15562440 missense probably damaging 0.96
R6753:Prdm9 UTSW 17 15544956 missense probably benign 0.00
R6857:Prdm9 UTSW 17 15544256 missense probably benign 0.04
R7041:Prdm9 UTSW 17 15544995 missense possibly damaging 0.56
R7355:Prdm9 UTSW 17 15545235 missense probably benign 0.01
R7410:Prdm9 UTSW 17 15544997 missense possibly damaging 0.73
R7570:Prdm9 UTSW 17 15555652 missense probably benign 0.14
R7571:Prdm9 UTSW 17 15563264 missense probably damaging 0.98
R7575:Prdm9 UTSW 17 15544628 missense probably damaging 1.00
R7593:Prdm9 UTSW 17 15544605 missense possibly damaging 0.81
R7664:Prdm9 UTSW 17 15555571 missense probably damaging 0.99
R7755:Prdm9 UTSW 17 15544964 missense probably damaging 1.00
R7817:Prdm9 UTSW 17 15559049 missense probably damaging 1.00
R7875:Prdm9 UTSW 17 15553542 nonsense probably null
R7958:Prdm9 UTSW 17 15553542 nonsense probably null
X0021:Prdm9 UTSW 17 15553472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTATCCTAGCTACTTTGGG -3'
(R):5'- CCTGGCCTTGTGATACATTTG -3'

Sequencing Primer
(F):5'- TGATATTTCTTGTTCATGCCCAG -3'
(R):5'- GATACATTTGTTCCATCCTCTAGGG -3'
Posted On2016-12-27