Incidental Mutation 'R5696:Capn2'
ID450639
Institutional Source Beutler Lab
Gene Symbol Capn2
Ensembl Gene ENSMUSG00000026509
Gene Namecalpain 2
SynonymsCapa-2, Capa2, m-calpain
Accession Numbers

Genbank: NM_009794 ; MGI: 88264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location182467260-182517608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 182478600 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 527 (E527G)
Ref Sequence ENSEMBL: ENSMUSP00000068895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068505
AA Change: E527G

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068895
Gene: ENSMUSG00000026509
AA Change: E527G

DomainStartEndE-ValueType
CysPc 27 352 1.62e-186 SMART
calpain_III 355 510 3.47e-90 SMART
low complexity region 513 532 N/A INTRINSIC
EFh 576 604 5.86e0 SMART
EFh 606 634 3.21e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194961
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Mice homozygous for one null allele display placental dysfunction, thin ventricular walls, and peripheral vessel failure. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Capn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Capn2 APN 1 182473954 splice site probably benign
IGL02589:Capn2 APN 1 182484348 missense probably damaging 1.00
IGL02679:Capn2 APN 1 182472584 missense probably benign
IGL03207:Capn2 APN 1 182489013 missense possibly damaging 0.92
E7848:Capn2 UTSW 1 182486594 missense possibly damaging 0.67
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0540:Capn2 UTSW 1 182492184 nonsense probably null
R0571:Capn2 UTSW 1 182470760 missense probably benign 0.01
R1620:Capn2 UTSW 1 182517137 missense probably damaging 1.00
R1818:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1819:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1822:Capn2 UTSW 1 182472960 missense possibly damaging 0.95
R1880:Capn2 UTSW 1 182489016 missense probably damaging 1.00
R2174:Capn2 UTSW 1 182479725 missense probably benign 0.22
R2391:Capn2 UTSW 1 182478609 missense probably benign 0.01
R2860:Capn2 UTSW 1 182472920 splice site probably benign
R2861:Capn2 UTSW 1 182472920 splice site probably benign
R2878:Capn2 UTSW 1 182517233 missense probably benign 0.00
R3052:Capn2 UTSW 1 182487772 missense probably benign 0.06
R4463:Capn2 UTSW 1 182479764 intron probably benign
R4669:Capn2 UTSW 1 182470780 missense probably benign 0.00
R5077:Capn2 UTSW 1 182472573 missense possibly damaging 0.71
R5397:Capn2 UTSW 1 182470706 missense probably damaging 1.00
R6777:Capn2 UTSW 1 182470177 critical splice donor site probably null
R6800:Capn2 UTSW 1 182481480 missense probably damaging 0.99
R7741:Capn2 UTSW 1 182479723 nonsense probably null
R7814:Capn2 UTSW 1 182492146 missense probably damaging 1.00
R7995:Capn2 UTSW 1 182478546 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGACGGGGACAATTCTTC -3'
(R):5'- CCTTTCATGGGCTTTAGCTAAAAC -3'

Sequencing Primer
(F):5'- TGACGGGGACAATTCTTCAGCTC -3'
(R):5'- GTCTAAGGGACAGGAAGACT -3'
Posted On2017-01-03