Incidental Mutation 'R5696:Zbtb48'
ID450651
Institutional Source Beutler Lab
Gene Symbol Zbtb48
Ensembl Gene ENSMUSG00000028952
Gene Namezinc finger and BTB domain containing 48
Synonyms0610011D15Rik, Hkr3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152019774-152027671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152020610 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 532 (H532N)
Ref Sequence ENSEMBL: ENSMUSP00000067521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066715] [ENSMUST00000097773] [ENSMUST00000155389] [ENSMUST00000156748]
PDB Structure
Solution structure of the tandem four zf-C2H2 domain repeats of murine GLI-Kruppel family member HKR3 [SOLUTION NMR]
Crystal structure of BTB domain from mouse HKR3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000066715
AA Change: H532N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952
AA Change: H532N

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097773
SMART Domains Protein: ENSMUSP00000095380
Gene: ENSMUSG00000073700

DomainStartEndE-ValueType
BTB 35 133 2.4e-27 SMART
BACK 138 239 3.93e-27 SMART
Kelch 287 334 1.08e0 SMART
Kelch 336 382 1.3e-7 SMART
Kelch 383 422 5.88e-1 SMART
Kelch 464 512 2.97e-1 SMART
Kelch 513 560 6.57e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147895
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155441
Predicted Effect probably benign
Transcript: ENSMUST00000156748
SMART Domains Protein: ENSMUSP00000117079
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
ZnF_C2H2 80 102 1.64e-1 SMART
ZnF_C2H2 108 128 2.06e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Other mutations in Zbtb48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zbtb48 APN 4 152021394 missense probably damaging 0.99
IGL02709:Zbtb48 APN 4 152021394 missense probably damaging 0.99
Etna UTSW 4 152021607 missense probably damaging 0.98
I0000:Zbtb48 UTSW 4 152019858 missense probably benign 0.34
R1515:Zbtb48 UTSW 4 152020201 unclassified probably null
R1844:Zbtb48 UTSW 4 152026498 missense probably benign
R2383:Zbtb48 UTSW 4 152026950 missense probably damaging 0.96
R3618:Zbtb48 UTSW 4 152026027 splice site probably null
R3619:Zbtb48 UTSW 4 152026027 splice site probably null
R5427:Zbtb48 UTSW 4 152020651 missense probably damaging 1.00
R6155:Zbtb48 UTSW 4 152022038 unclassified probably null
R6157:Zbtb48 UTSW 4 152021607 missense probably damaging 0.98
R6551:Zbtb48 UTSW 4 152022221 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGAAGGTTCTGAGGAGCATG -3'
(R):5'- AGAAGCCTTTCCAGTGCCAC -3'

Sequencing Primer
(F):5'- ATGCAGAAGCTACCGGTGC -3'
(R):5'- ACCTCTGTGGGAAGACCTTC -3'
Posted On2017-01-03