Mutagenetix > Incidental Mutation

Incidental Mutation 'R5696:Polr1a'

450661

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5696 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71929426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 409 (F409I)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]

AlphaFold

O35134

Predicted Effect

probably benign
Transcript: ENSMUST00000055296
AA Change: F409I

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: F409I

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205333

Predicted Effect

probably benign
Transcript: ENSMUST00000206556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206823

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam8	G	A	7: 139,989,246	R186W	probably benign	Het
Afg3l2	A	G	18: 67,407,459	I660T	probably damaging	Het
Amtn	T	A	5: 88,385,085	Y186*	probably null	Het
Atrip	A	G	9: 109,065,501	S453P	possibly damaging	Het
Bahcc1	T	C	11: 120,273,987	L840P	probably damaging	Het
Capn2	T	C	1: 182,478,600	E527G	possibly damaging	Het
Caprin2	A	T	6: 148,877,818	Y164N	possibly damaging	Het
Ccnh	T	A	13: 85,196,327		probably null	Het
Cdon	G	T	9: 35,491,866	V1091F	possibly damaging	Het
Ceacam14	A	G	7: 17,814,342	Y119C	probably damaging	Het
Ces2h	A	G	8: 105,018,979	K445E	possibly damaging	Het
Cfap46	A	G	7: 139,612,031	S2357P	probably damaging	Het
Commd4	A	T	9: 57,156,215	S86R	possibly damaging	Het
Cpsf6	A	T	10: 117,361,029		probably benign	Het
Dag1	A	T	9: 108,209,447	V165E	probably benign	Het
Dmxl1	A	T	18: 49,931,941	K2618*	probably null	Het
Dnah17	A	G	11: 118,101,056	Y1229H	probably benign	Het
Endov	T	A	11: 119,491,799	L24Q	probably damaging	Het
Fam214a	A	G	9: 75,010,117	E666G	probably benign	Het
Fap	C	T	2: 62,502,459	V717M	probably damaging	Het
Fbxl2	A	G	9: 113,986,478	L239P	probably damaging	Het
Fbxl5	A	T	5: 43,758,840	V367D	possibly damaging	Het
Fkbp10	G	T	11: 100,423,526	W384L	probably damaging	Het
Gbp8	C	T	5: 105,018,816	V216I	possibly damaging	Het
Gclm	G	A	3: 122,266,287	A239T	probably benign	Het
Gm11569	C	T	11: 99,798,730		probably benign	Het
Gm14124	C	T	2: 150,269,474	H695Y	possibly damaging	Het
Gnas	C	A	2: 174,299,675		probably benign	Het
Grb10	T	A	11: 11,933,566	N508I	probably benign	Het
Gykl1	T	G	18: 52,694,195	I158M	probably benign	Het
Ide	G	A	19: 37,318,021	T214M	unknown	Het
Il12rb2	T	A	6: 67,295,278	Q341H	possibly damaging	Het
Ints1	T	C	5: 139,754,989	E1946G	probably benign	Het
Kdelr3	T	C	15: 79,525,899		probably null	Het
Kif1b	A	C	4: 149,273,849		probably null	Het
Kri1	A	G	9: 21,280,237	I320T	probably damaging	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lin9	T	C	1: 180,659,081	S111P	probably benign	Het
Lpcat2b	C	A	5: 107,432,907	P34Q	probably damaging	Het
Ltk	T	A	2: 119,759,599	T49S	probably benign	Het
Map3k9	A	T	12: 81,734,122	H421Q	probably benign	Het
Mapkbp1	T	A	2: 120,021,720		probably null	Het
Mcm4	A	G	16: 15,625,570	S830P	probably damaging	Het
Nek10	T	A	14: 14,860,736		probably null	Het
Nlrp9b	A	T	7: 20,024,492	R551S	probably benign	Het
Nol4l	T	C	2: 153,418,106	T143A	probably damaging	Het
Olfr1346	T	C	7: 6,474,743		probably null	Het
Olfr1355	A	T	10: 78,880,085	R304S	probably benign	Het
Olfr398	T	C	11: 73,984,536	H24R	possibly damaging	Het
Olfr578	T	A	7: 102,984,541	T208S	probably benign	Het
Pde4dip	G	T	3: 97,709,490	A1812D	probably damaging	Het
Plekhb1	C	A	7: 100,656,753	G26C	probably damaging	Het
Ptpn13	T	A	5: 103,554,759	M1197K	probably benign	Het
Qrich2	T	C	11: 116,445,002	I2114V	probably damaging	Het
Rbm27	T	C	18: 42,317,666	Y449H	probably damaging	Het
Rp1l1	A	G	14: 64,029,746	D927G	probably damaging	Het
Secisbp2	C	A	13: 51,679,821	Q666K	probably damaging	Het
Slc45a2	T	C	15: 11,001,133	I106T	probably damaging	Het
Slx4	G	T	16: 3,979,967	Q1518K	probably damaging	Het
Smim10l1	T	C	6: 133,105,526	F12S	probably damaging	Het
Son	T	C	16: 91,671,413	V306A	possibly damaging	Het
Stab1	A	G	14: 31,160,221	S506P	probably benign	Het
Syne2	A	C	12: 75,994,145	D3859A	probably benign	Het
Tab1	T	A	15: 80,148,729	Y71*	probably null	Het
Tarbp1	A	C	8: 126,447,340	M909R	probably damaging	Het
Tex15	T	G	8: 33,573,192	S1157R	probably benign	Het
Tnni3	G	A	7: 4,520,454	T120I	probably benign	Het
Ttn	T	C	2: 76,917,544	E4387G	probably benign	Het
Ugt3a2	G	A	15: 9,361,448		silent	Het
Unc5d	T	C	8: 28,666,842	I783V	probably benign	Het
Usp40	T	C	1: 87,995,752	T266A	probably benign	Het
Vmn2r59	C	T	7: 42,046,044	V315I	probably benign	Het
Zbtb48	G	T	4: 152,020,610	H532N	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0267:Polr1a	UTSW	6	71974139	missense	probably damaging	0.99
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CTCATTAAGGGCTAGGTTGAGTAAC -3'
(R):5'- GGAACAGGCCTTCCTTCTTC -3'

Sequencing Primer
(F):5'- ATGACTCCTCAGTGGCTA -3'
(R):5'- CTTCTTGCTTCTGAAACAGTGAG -3'

Posted On

2017-01-03