Incidental Mutation 'R5696:Ces2h'
ID450674
Institutional Source Beutler Lab
Gene Symbol Ces2h
Ensembl Gene ENSMUSG00000091813
Gene Namecarboxylesterase 2H
SynonymsGm5744
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105000853-105021178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105018979 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 445 (K445E)
Ref Sequence ENSEMBL: ENSMUSP00000126773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172032]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172032
AA Change: K445E

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: K445E

DomainStartEndE-ValueType
Pfam:COesterase 9 537 2.5e-167 PFAM
Pfam:Abhydrolase_3 142 275 4.1e-11 PFAM
Pfam:Peptidase_S9 161 326 3.3e-8 PFAM
coiled coil region 538 558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Ces2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Ces2h APN 8 105014484 missense probably benign 0.01
IGL02268:Ces2h APN 8 105019940 missense probably benign 0.00
IGL03133:Ces2h APN 8 105016779 missense probably damaging 1.00
R0138:Ces2h UTSW 8 105018061 missense probably benign 0.01
R0294:Ces2h UTSW 8 105016604 missense probably benign 0.01
R0482:Ces2h UTSW 8 105020271 missense possibly damaging 0.48
R0899:Ces2h UTSW 8 105014550 missense probably damaging 1.00
R1232:Ces2h UTSW 8 105014655 missense probably benign 0.38
R1535:Ces2h UTSW 8 105014486 missense probably benign 0.06
R1738:Ces2h UTSW 8 105019065 critical splice donor site probably null
R1748:Ces2h UTSW 8 105017841 missense probably benign 0.00
R1759:Ces2h UTSW 8 105016611 missense probably damaging 1.00
R1778:Ces2h UTSW 8 105014607 missense possibly damaging 0.93
R1833:Ces2h UTSW 8 105020373 missense possibly damaging 0.93
R1999:Ces2h UTSW 8 105020345 missense probably benign 0.03
R2018:Ces2h UTSW 8 105018398 missense probably damaging 1.00
R2076:Ces2h UTSW 8 105019028 missense probably benign
R2261:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2262:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2356:Ces2h UTSW 8 105015938 missense probably damaging 0.98
R4453:Ces2h UTSW 8 105014656 critical splice donor site probably null
R4656:Ces2h UTSW 8 105014639 missense possibly damaging 0.80
R4732:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R4733:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R5219:Ces2h UTSW 8 105016646 missense probably damaging 1.00
R5400:Ces2h UTSW 8 105018425 missense probably benign 0.01
R5894:Ces2h UTSW 8 105019026 missense probably benign 0.14
R6688:Ces2h UTSW 8 105017840 missense probably benign
R6711:Ces2h UTSW 8 105018083 missense probably benign 0.22
R6868:Ces2h UTSW 8 105018423 missense probably benign 0.02
R7233:Ces2h UTSW 8 105017456 missense probably damaging 0.99
R7516:Ces2h UTSW 8 105016826 missense probably damaging 1.00
R7710:Ces2h UTSW 8 105000865 nonsense probably null
R7735:Ces2h UTSW 8 105014495 missense probably benign 0.01
R7803:Ces2h UTSW 8 105018400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTCAACCAAGGCCCTCC -3'
(R):5'- CCTTTTGTGATACATCATGGCAC -3'

Sequencing Primer
(F):5'- GATCCCTGCTCTAGCCTGG -3'
(R):5'- ACATAAGCCACAATGTCTTTACTCTC -3'
Posted On2017-01-03