Incidental Mutation 'R5696:Olfr1355'
ID450683
Institutional Source Beutler Lab
Gene Symbol Olfr1355
Ensembl Gene ENSMUSG00000062873
Gene Nameolfactory receptor 1355
SynonymsGA_x6K02T2QGN0-2932609-2931677, MOR139-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78875540-78882266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78880085 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 304 (R304S)
Ref Sequence ENSEMBL: ENSMUSP00000077517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078414]
Predicted Effect probably benign
Transcript: ENSMUST00000078414
AA Change: R304S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077517
Gene: ENSMUSG00000062873
AA Change: R304S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.1e-48 PFAM
Pfam:7tm_1 42 291 1.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Olfr1355
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Olfr1355 APN 10 78879837 missense possibly damaging 0.95
IGL01773:Olfr1355 APN 10 78879936 missense possibly damaging 0.86
IGL02707:Olfr1355 APN 10 78879925 missense probably damaging 1.00
IGL03233:Olfr1355 APN 10 78879572 nonsense probably null
R1067:Olfr1355 UTSW 10 78879683 nonsense probably null
R1201:Olfr1355 UTSW 10 78879477 missense probably benign 0.12
R1956:Olfr1355 UTSW 10 78879433 missense probably benign 0.28
R1978:Olfr1355 UTSW 10 78879280 missense probably damaging 1.00
R2014:Olfr1355 UTSW 10 78879388 missense possibly damaging 0.94
R2015:Olfr1355 UTSW 10 78879388 missense possibly damaging 0.94
R2245:Olfr1355 UTSW 10 78879931 missense probably damaging 0.98
R3725:Olfr1355 UTSW 10 78879932 nonsense probably null
R4899:Olfr1355 UTSW 10 78879207 missense probably benign 0.32
R5982:Olfr1355 UTSW 10 78879953 nonsense probably null
R6448:Olfr1355 UTSW 10 78879682 missense possibly damaging 0.78
R7126:Olfr1355 UTSW 10 78879577 missense possibly damaging 0.50
R7385:Olfr1355 UTSW 10 78879454 missense probably damaging 0.97
R7807:Olfr1355 UTSW 10 78879209 missense probably benign
R7886:Olfr1355 UTSW 10 78879823 missense possibly damaging 0.59
R7969:Olfr1355 UTSW 10 78879823 missense possibly damaging 0.59
Z1177:Olfr1355 UTSW 10 78879156 critical splice acceptor site probably null
Z1177:Olfr1355 UTSW 10 78879559 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACAAGGCATTTTCTACATGTGTCTC -3'
(R):5'- GGGATATCATAGGCACCCAC -3'

Sequencing Primer
(F):5'- GGCATTTTCTACATGTGTCTCTCACC -3'
(R):5'- AAGGGTGATGCATCCCTTGAATC -3'
Posted On2017-01-03