Incidental Mutation 'R5696:Grb10'
ID450685
Institutional Source Beutler Lab
Gene Symbol Grb10
Ensembl Gene ENSMUSG00000020176
Gene Namegrowth factor receptor bound protein 10
Synonyms5730571D09Rik, maternally expressed gene 1, Meg1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location11930508-12038683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11933566 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 508 (N508I)
Ref Sequence ENSEMBL: ENSMUSP00000105281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093321] [ENSMUST00000109653] [ENSMUST00000109654]
Predicted Effect probably benign
Transcript: ENSMUST00000093321
AA Change: N563I

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091011
Gene: ENSMUSG00000020176
AA Change: N563I

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
PH 294 404 7.13e-10 SMART
Pfam:BPS 427 473 6.4e-31 PFAM
SH2 493 582 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109653
AA Change: N517I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105280
Gene: ENSMUSG00000020176
AA Change: N517I

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
Blast:PH 285 358 1e-44 BLAST
Pfam:BPS 381 428 3.5e-33 PFAM
SH2 447 536 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109654
AA Change: N508I

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105281
Gene: ENSMUSG00000020176
AA Change: N508I

DomainStartEndE-ValueType
RA 114 198 5.45e-24 SMART
PH 239 349 7.13e-10 SMART
Pfam:BPS 372 419 5.4e-33 PFAM
SH2 438 527 7.78e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124587
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
PHENOTYPE: Maternal transmission of a mutant allele results in both fetal and placental overgrowth. Disproportionate overgrowth of the liver is observed. Paternal transmission of an allele lacking the differentially methylated region results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Grb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Grb10 APN 11 11945599 missense probably damaging 1.00
IGL01450:Grb10 APN 11 11970432 missense probably damaging 1.00
IGL01872:Grb10 APN 11 11970547 missense probably damaging 0.99
IGL02164:Grb10 APN 11 11943962 missense probably damaging 1.00
IGL02508:Grb10 APN 11 11946767 missense probably damaging 1.00
IGL02626:Grb10 APN 11 11945503 missense probably benign 0.00
IGL03275:Grb10 APN 11 11933591 missense possibly damaging 0.46
virginia UTSW 11 11933551 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0089:Grb10 UTSW 11 11934192 splice site probably benign
R0196:Grb10 UTSW 11 11945583 missense probably damaging 1.00
R0419:Grb10 UTSW 11 11934207 missense possibly damaging 0.87
R0645:Grb10 UTSW 11 11936755 missense probably damaging 0.98
R1473:Grb10 UTSW 11 11934249 missense probably damaging 1.00
R1848:Grb10 UTSW 11 11946029 missense possibly damaging 0.78
R2025:Grb10 UTSW 11 11970576 nonsense probably null
R4455:Grb10 UTSW 11 11967665 missense possibly damaging 0.93
R4857:Grb10 UTSW 11 11951469 unclassified probably benign
R5289:Grb10 UTSW 11 11944924 splice site silent
R5522:Grb10 UTSW 11 11936746 missense probably benign 0.05
R6119:Grb10 UTSW 11 11933551 missense probably damaging 1.00
R6163:Grb10 UTSW 11 11943932 nonsense probably null
R6267:Grb10 UTSW 11 11970639 start gained probably benign
R6328:Grb10 UTSW 11 11937905 missense probably damaging 1.00
R6741:Grb10 UTSW 11 11936717 critical splice donor site probably null
R7610:Grb10 UTSW 11 11943955 missense probably benign 0.33
R7641:Grb10 UTSW 11 11933492 missense possibly damaging 0.84
R8209:Grb10 UTSW 11 11951533 missense probably damaging 0.99
R8226:Grb10 UTSW 11 11951533 missense probably damaging 0.99
Z1176:Grb10 UTSW 11 11944845 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GTGTTCTCACCCTCATGCAG -3'
(R):5'- GAAACAGTTCTACCCTTGGTCC -3'

Sequencing Primer
(F):5'- GTTCTCACCCTCATGCAGATCTC -3'
(R):5'- TTCCACTGTGCCATTAGAGAAC -3'
Posted On2017-01-03