Incidental Mutation 'R5696:Bahcc1'
ID450693
Institutional Source Beutler Lab
Gene Symbol Bahcc1
Ensembl Gene ENSMUSG00000039741
Gene NameBAH domain and coiled-coil containing 1
SynonymsKIAA1447
Accession Numbers

Genbank: NM_198423; MGI: 2679272

Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120232947-120292296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120273987 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 840 (L840P)
Ref Sequence ENSEMBL: ENSMUSP00000112827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044985] [ENSMUST00000118987] [ENSMUST00000122148]
Predicted Effect probably damaging
Transcript: ENSMUST00000044985
AA Change: L840P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043643
Gene: ENSMUSG00000039741
AA Change: L840P

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118987
AA Change: L840P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112784
Gene: ENSMUSG00000039741
AA Change: L840P

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122148
AA Change: L840P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112827
Gene: ENSMUSG00000039741
AA Change: L840P

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality for the majority of mutants. Those that survive exhibit hind leg motor dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(2) Gene trapped(24)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Bahcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bahcc1 APN 11 120272304 missense probably damaging 1.00
IGL00536:Bahcc1 APN 11 120285045 missense probably damaging 0.96
IGL01339:Bahcc1 APN 11 120289512 missense probably damaging 1.00
IGL01695:Bahcc1 APN 11 120276609 missense probably benign 0.02
IGL01744:Bahcc1 APN 11 120271737 missense probably benign 0.02
IGL01769:Bahcc1 APN 11 120280204 splice site probably benign
IGL01982:Bahcc1 APN 11 120287473 missense probably damaging 1.00
IGL02341:Bahcc1 APN 11 120272520 missense probably damaging 1.00
IGL02535:Bahcc1 APN 11 120287536 missense possibly damaging 0.88
IGL02559:Bahcc1 APN 11 120285172 missense probably damaging 0.97
IGL02579:Bahcc1 APN 11 120285349 splice site probably benign
IGL02609:Bahcc1 APN 11 120289398 missense possibly damaging 0.93
IGL02678:Bahcc1 APN 11 120272871 missense probably damaging 1.00
IGL02800:Bahcc1 APN 11 120272934 missense probably damaging 1.00
IGL02963:Bahcc1 APN 11 120274932 missense possibly damaging 0.86
IGL03128:Bahcc1 APN 11 120268434 splice site probably benign
IGL03242:Bahcc1 APN 11 120268300 splice site probably benign
IGL03248:Bahcc1 APN 11 120268409 missense probably damaging 1.00
Dimensionality UTSW 11 120273009 missense probably damaging 1.00
R0019:Bahcc1 UTSW 11 120289771 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0148:Bahcc1 UTSW 11 120268404 missense probably damaging 1.00
R0164:Bahcc1 UTSW 11 120285074 splice site probably benign
R0321:Bahcc1 UTSW 11 120273425 critical splice donor site probably null
R0671:Bahcc1 UTSW 11 120287320 missense probably damaging 1.00
R0737:Bahcc1 UTSW 11 120272841 missense probably damaging 1.00
R1452:Bahcc1 UTSW 11 120282239 splice site probably benign
R1570:Bahcc1 UTSW 11 120272183 missense possibly damaging 0.74
R1914:Bahcc1 UTSW 11 120285399 missense probably damaging 1.00
R2010:Bahcc1 UTSW 11 120272778 missense probably damaging 1.00
R2075:Bahcc1 UTSW 11 120271689 missense probably damaging 1.00
R2085:Bahcc1 UTSW 11 120288082 missense probably damaging 1.00
R3552:Bahcc1 UTSW 11 120276772 missense possibly damaging 0.90
R3711:Bahcc1 UTSW 11 120275097 missense probably benign 0.27
R3804:Bahcc1 UTSW 11 120283358 missense probably benign 0.01
R4349:Bahcc1 UTSW 11 120259201 missense probably damaging 1.00
R4557:Bahcc1 UTSW 11 120275088 missense probably damaging 1.00
R4801:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4802:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4908:Bahcc1 UTSW 11 120287754 missense probably benign 0.36
R4941:Bahcc1 UTSW 11 120286665 missense probably benign
R5217:Bahcc1 UTSW 11 120274459 nonsense probably null
R5241:Bahcc1 UTSW 11 120271403 missense probably damaging 1.00
R5432:Bahcc1 UTSW 11 120287988 missense probably benign 0.02
R5724:Bahcc1 UTSW 11 120285366 missense possibly damaging 0.78
R5725:Bahcc1 UTSW 11 120274888 missense probably benign
R5788:Bahcc1 UTSW 11 120286352 missense probably damaging 1.00
R5893:Bahcc1 UTSW 11 120285430 missense probably damaging 0.99
R5900:Bahcc1 UTSW 11 120284493 missense probably damaging 1.00
R6014:Bahcc1 UTSW 11 120289789 missense probably benign 0.00
R6058:Bahcc1 UTSW 11 120287385 missense probably damaging 1.00
R6107:Bahcc1 UTSW 11 120272888 missense probably benign 0.00
R6302:Bahcc1 UTSW 11 120276808 missense probably damaging 1.00
R6525:Bahcc1 UTSW 11 120285222 missense probably damaging 1.00
R6550:Bahcc1 UTSW 11 120276651 missense possibly damaging 0.94
R6822:Bahcc1 UTSW 11 120287721 missense probably damaging 1.00
R6836:Bahcc1 UTSW 11 120271757 nonsense probably null
R6846:Bahcc1 UTSW 11 120271596 missense possibly damaging 0.92
R6916:Bahcc1 UTSW 11 120273009 missense probably damaging 1.00
R6966:Bahcc1 UTSW 11 120283159 missense probably damaging 0.99
R7097:Bahcc1 UTSW 11 120272646 missense possibly damaging 0.87
R7289:Bahcc1 UTSW 11 120280174 missense probably benign 0.08
R7441:Bahcc1 UTSW 11 120286306 missense probably damaging 0.99
R7520:Bahcc1 UTSW 11 120276205 missense possibly damaging 0.47
R7556:Bahcc1 UTSW 11 120287763 missense probably damaging 1.00
R7672:Bahcc1 UTSW 11 120283346 missense possibly damaging 0.63
R7791:Bahcc1 UTSW 11 120268377 missense probably damaging 1.00
R7794:Bahcc1 UTSW 11 120272681 nonsense probably null
R7802:Bahcc1 UTSW 11 120274692 missense probably benign 0.03
X0026:Bahcc1 UTSW 11 120271752 missense probably benign 0.20
Z1176:Bahcc1 UTSW 11 120276609 missense possibly damaging 0.89
Z1176:Bahcc1 UTSW 11 120284394 missense probably benign 0.00
Z1177:Bahcc1 UTSW 11 120272921 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGGAATTTGCCCGGATCCAC -3'
(R):5'- TAGACTGCAGAGGGTCCTTAC -3'

Sequencing Primer
(F):5'- ACCTCATGATGCAAGGCG -3'
(R):5'- CCTTACCGAGTGTGTGAGG -3'
Posted On2017-01-03