Incidental Mutation 'R5696:Map3k9'
ID450695
Institutional Source Beutler Lab
Gene Symbol Map3k9
Ensembl Gene ENSMUSG00000042724
Gene Namemitogen-activated protein kinase kinase kinase 9
SynonymsMlk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81721010-81781175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81734122 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 421 (H421Q)
Ref Sequence ENSEMBL: ENSMUSP00000152201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035987] [ENSMUST00000222322]
Predicted Effect probably benign
Transcript: ENSMUST00000035987
AA Change: H421Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041819
Gene: ENSMUSG00000042724
AA Change: H421Q

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
SH3 48 108 1.61e-20 SMART
TyrKc 137 396 6.72e-89 SMART
low complexity region 449 469 N/A INTRINSIC
low complexity region 573 590 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 736 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
low complexity region 901 915 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222322
AA Change: H421Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223292
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Map3k9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Map3k9 APN 12 81729698 missense probably benign 0.00
IGL01098:Map3k9 APN 12 81724154 missense probably damaging 1.00
IGL01122:Map3k9 APN 12 81732126 missense possibly damaging 0.94
IGL01680:Map3k9 APN 12 81724739 missense probably benign 0.10
IGL01997:Map3k9 APN 12 81772697 missense probably damaging 1.00
IGL02178:Map3k9 APN 12 81743837 missense probably damaging 1.00
IGL02724:Map3k9 APN 12 81724742 missense probably benign
PIT4366001:Map3k9 UTSW 12 81772761 missense possibly damaging 0.95
R0530:Map3k9 UTSW 12 81722482 missense probably benign 0.00
R0541:Map3k9 UTSW 12 81734223 missense possibly damaging 0.79
R0550:Map3k9 UTSW 12 81725781 missense probably damaging 1.00
R0799:Map3k9 UTSW 12 81722269 missense probably benign 0.27
R1730:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1783:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1859:Map3k9 UTSW 12 81724482 missense possibly damaging 0.82
R1917:Map3k9 UTSW 12 81780790 nonsense probably null
R3121:Map3k9 UTSW 12 81743924 missense probably damaging 1.00
R3779:Map3k9 UTSW 12 81743791 splice site probably benign
R3931:Map3k9 UTSW 12 81772917 missense probably damaging 0.99
R3951:Map3k9 UTSW 12 81722521 missense probably benign
R4571:Map3k9 UTSW 12 81734091 missense probably benign 0.25
R4728:Map3k9 UTSW 12 81722373 missense probably damaging 0.96
R4857:Map3k9 UTSW 12 81724627 missense probably benign 0.42
R4882:Map3k9 UTSW 12 81724162 missense probably damaging 1.00
R5077:Map3k9 UTSW 12 81734077 splice site probably null
R5369:Map3k9 UTSW 12 81722052 missense probably damaging 0.98
R5418:Map3k9 UTSW 12 81743817 nonsense probably null
R5540:Map3k9 UTSW 12 81772813 missense probably damaging 1.00
R5567:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5570:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R6539:Map3k9 UTSW 12 81732192 missense probably damaging 0.98
R6542:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6816:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6964:Map3k9 UTSW 12 81773003 missense probably benign 0.00
R7027:Map3k9 UTSW 12 81730624 missense probably benign 0.06
R7055:Map3k9 UTSW 12 81724208 missense probably damaging 0.99
R7082:Map3k9 UTSW 12 81724702 missense probably damaging 1.00
R7247:Map3k9 UTSW 12 81725830 missense possibly damaging 0.65
R7424:Map3k9 UTSW 12 81724097 missense probably benign 0.00
R7476:Map3k9 UTSW 12 81743808 missense probably damaging 1.00
R7638:Map3k9 UTSW 12 81724732 missense probably benign 0.00
R8098:Map3k9 UTSW 12 81734114 missense probably damaging 0.99
R8249:Map3k9 UTSW 12 81780777 missense unknown
R8356:Map3k9 UTSW 12 81734118 missense probably damaging 0.98
R8397:Map3k9 UTSW 12 81722362 missense probably benign 0.13
R8444:Map3k9 UTSW 12 81722196 missense probably damaging 1.00
R8456:Map3k9 UTSW 12 81734118 missense probably damaging 0.98
X0025:Map3k9 UTSW 12 81724412 missense possibly damaging 0.58
Z1176:Map3k9 UTSW 12 81772782 missense possibly damaging 0.76
Z1177:Map3k9 UTSW 12 81722279 missense probably damaging 0.99
Z1177:Map3k9 UTSW 12 81780846 missense unknown
Predicted Primers PCR Primer
(F):5'- GAACGCTTTCCACAAAATCATG -3'
(R):5'- ATGAAGCTTCCGTTTGCCTC -3'

Sequencing Primer
(F):5'- AAATGTCAGTTTCAGGTTCCTATCC -3'
(R):5'- GCCTCTGCCTACCCCAC -3'
Posted On2017-01-03