Incidental Mutation 'R5697:Chd6'
ID450717
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161018051 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 610 (L610P)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: L610P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: L610P

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134178
AA Change: L609P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: L609P

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138078
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense not run
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGCAGTTCCAGGTTACAAATTC -3'
(R):5'- AGCTGTGGTGTAAAGCTCTG -3'

Sequencing Primer
(F):5'- ACAAGGCCATGGGATACT -3'
(R):5'- GCTTTTGGCTTGTCATCCTCAGG -3'
Posted On2017-01-03