Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Dnaic1'

45072

Institutional Source

Beutler Lab

Gene Symbol

Dnaic1

Ensembl Gene

ENSMUSG00000061322

Gene Name

dynein, axonemal, intermediate chain 1

Synonyms

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.600) question?

Stock #

R0550 (G1)

Quality Score

110

Status

Validated

Chromosome

Chromosomal Location

41569775-41638158 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 41596274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 20 (R20*)

Ref Sequence

ENSEMBL: ENSMUSP00000100028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102963]

AlphaFold

Q8C0M8

Predicted Effect

probably null
Transcript: ENSMUST00000102963
AA Change: R20*

SMART Domains

Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: R20*

Domain	Start	End	E-Value	Type
low complexity region	134	158	N/A	INTRINSIC
low complexity region	238	261	N/A	INTRINSIC
Blast:WD40	319	370	1e-17	BLAST
WD40	374	413	1.5e-3	SMART
WD40	419	465	4.4e-2	SMART
Blast:WD40	493	526	5e-13	BLAST
WD40	530	570	9.3e-9	SMART
WD40	575	612	6e-3	SMART
WD40	623	659	1.4e0	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Dnaic1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02678:Dnaic1	APN	4	41602917	missense	probably benign	0.03
IGL02825:Dnaic1	APN	4	41625101	splice site	probably benign
IGL03072:Dnaic1	APN	4	41602979	missense	probably benign	0.00
H8562:Dnaic1	UTSW	4	41629833	missense	possibly damaging	0.81
R0114:Dnaic1	UTSW	4	41605686	splice site	probably benign
R0138:Dnaic1	UTSW	4	41629814	missense	possibly damaging	0.49
R0153:Dnaic1	UTSW	4	41635162	unclassified	probably benign
R0465:Dnaic1	UTSW	4	41629988	splice site	probably null
R0555:Dnaic1	UTSW	4	41625335	missense	possibly damaging	0.64
R0890:Dnaic1	UTSW	4	41604253	missense	possibly damaging	0.69
R0928:Dnaic1	UTSW	4	41602566	missense	possibly damaging	0.57
R0944:Dnaic1	UTSW	4	41629997	missense	probably benign
R1714:Dnaic1	UTSW	4	41632164	missense	probably benign	0.12
R1902:Dnaic1	UTSW	4	41625319	nonsense	probably null
R1919:Dnaic1	UTSW	4	41570020	critical splice donor site	probably null
R1983:Dnaic1	UTSW	4	41603232	missense	probably benign
R2036:Dnaic1	UTSW	4	41632225	missense	probably damaging	1.00
R2306:Dnaic1	UTSW	4	41625239	missense	probably benign
R2925:Dnaic1	UTSW	4	41597919	missense	probably damaging	1.00
R3404:Dnaic1	UTSW	4	41603246	missense	probably benign	0.00
R3720:Dnaic1	UTSW	4	41602615	missense	probably damaging	1.00
R3721:Dnaic1	UTSW	4	41602615	missense	probably damaging	1.00
R3722:Dnaic1	UTSW	4	41602615	missense	probably damaging	1.00
R3931:Dnaic1	UTSW	4	41604229	missense	probably damaging	1.00
R4330:Dnaic1	UTSW	4	41637966	missense	probably damaging	1.00
R4755:Dnaic1	UTSW	4	41610269	missense	probably damaging	0.99
R4905:Dnaic1	UTSW	4	41614269	missense	probably benign	0.05
R4997:Dnaic1	UTSW	4	41597919	missense	possibly damaging	0.80
R5088:Dnaic1	UTSW	4	41597630	missense	probably benign	0.00
R5088:Dnaic1	UTSW	4	41632251	missense	probably benign	0.02
R5970:Dnaic1	UTSW	4	41625281	missense	probably benign	0.14
R5987:Dnaic1	UTSW	4	41632391	missense	probably benign	0.03
R6247:Dnaic1	UTSW	4	41605775	missense	probably benign
R6727:Dnaic1	UTSW	4	41625308	missense	probably benign
R6874:Dnaic1	UTSW	4	41632412	missense	probably damaging	1.00
R6914:Dnaic1	UTSW	4	41625176	missense	probably benign	0.01
R7508:Dnaic1	UTSW	4	41614323	missense	probably benign	0.01
R7831:Dnaic1	UTSW	4	41614695	critical splice donor site	probably null
R7832:Dnaic1	UTSW	4	41605823	missense	probably benign	0.42
R7985:Dnaic1	UTSW	4	41630055	missense	probably benign
R8065:Dnaic1	UTSW	4	41614258	missense	probably damaging	1.00
R8067:Dnaic1	UTSW	4	41614258	missense	probably damaging	1.00
R8234:Dnaic1	UTSW	4	41625221	missense	probably benign	0.00
R8906:Dnaic1	UTSW	4	41625125	missense	probably benign	0.00
R9537:Dnaic1	UTSW	4	41629790	critical splice acceptor site	probably null
R9723:Dnaic1	UTSW	4	41603302	missense	possibly damaging	0.95
X0065:Dnaic1	UTSW	4	41629868	missense	possibly damaging	0.89
Z1176:Dnaic1	UTSW	4	41614323	missense	probably benign	0.32
Z1177:Dnaic1	UTSW	4	41569809	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGTCTCATACGTACCATTCAACACTG -3'
(R):5'- TGCATGTTAAATGGAAGGCCATCCTG -3'

Sequencing Primer
(F):5'- caacactgaccaacaaagctac -3'
(R):5'- CCATCCTGGGGTAGTAGCTTAA -3'

Posted On

2013-06-11