Incidental Mutation 'R0550:Dnai1'
ID 45072
Institutional Source Beutler Lab
Gene Symbol Dnai1
Ensembl Gene ENSMUSG00000061322
Gene Name dynein axonemal intermediate chain 1
Synonyms b2b1526Clo, Dnaic1, 1110066F04Rik
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R0550 (G1)
Quality Score 110
Status Validated
Chromosome 4
Chromosomal Location 41569775-41638158 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 41596274 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 20 (R20*)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963]
AlphaFold Q8C0M8
Predicted Effect probably null
Transcript: ENSMUST00000102963
AA Change: R20*
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: R20*

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Dnai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnai1 APN 4 41,602,917 (GRCm39) missense probably benign 0.03
IGL02825:Dnai1 APN 4 41,625,101 (GRCm39) splice site probably benign
IGL03072:Dnai1 APN 4 41,602,979 (GRCm39) missense probably benign 0.00
H8562:Dnai1 UTSW 4 41,629,833 (GRCm39) missense possibly damaging 0.81
R0114:Dnai1 UTSW 4 41,605,686 (GRCm39) splice site probably benign
R0138:Dnai1 UTSW 4 41,629,814 (GRCm39) missense possibly damaging 0.49
R0153:Dnai1 UTSW 4 41,635,162 (GRCm39) unclassified probably benign
R0465:Dnai1 UTSW 4 41,629,988 (GRCm39) splice site probably null
R0555:Dnai1 UTSW 4 41,625,335 (GRCm39) missense possibly damaging 0.64
R0890:Dnai1 UTSW 4 41,604,253 (GRCm39) missense possibly damaging 0.69
R0928:Dnai1 UTSW 4 41,602,566 (GRCm39) missense possibly damaging 0.57
R0944:Dnai1 UTSW 4 41,629,997 (GRCm39) missense probably benign
R1714:Dnai1 UTSW 4 41,632,164 (GRCm39) missense probably benign 0.12
R1902:Dnai1 UTSW 4 41,625,319 (GRCm39) nonsense probably null
R1919:Dnai1 UTSW 4 41,570,020 (GRCm39) critical splice donor site probably null
R1983:Dnai1 UTSW 4 41,603,232 (GRCm39) missense probably benign
R2036:Dnai1 UTSW 4 41,632,225 (GRCm39) missense probably damaging 1.00
R2306:Dnai1 UTSW 4 41,625,239 (GRCm39) missense probably benign
R2925:Dnai1 UTSW 4 41,597,919 (GRCm39) missense probably damaging 1.00
R3404:Dnai1 UTSW 4 41,603,246 (GRCm39) missense probably benign 0.00
R3720:Dnai1 UTSW 4 41,602,615 (GRCm39) missense probably damaging 1.00
R3721:Dnai1 UTSW 4 41,602,615 (GRCm39) missense probably damaging 1.00
R3722:Dnai1 UTSW 4 41,602,615 (GRCm39) missense probably damaging 1.00
R3931:Dnai1 UTSW 4 41,604,229 (GRCm39) missense probably damaging 1.00
R4330:Dnai1 UTSW 4 41,637,966 (GRCm39) missense probably damaging 1.00
R4755:Dnai1 UTSW 4 41,610,269 (GRCm39) missense probably damaging 0.99
R4905:Dnai1 UTSW 4 41,614,269 (GRCm39) missense probably benign 0.05
R4997:Dnai1 UTSW 4 41,597,919 (GRCm39) missense possibly damaging 0.80
R5088:Dnai1 UTSW 4 41,632,251 (GRCm39) missense probably benign 0.02
R5088:Dnai1 UTSW 4 41,597,630 (GRCm39) missense probably benign 0.00
R5970:Dnai1 UTSW 4 41,625,281 (GRCm39) missense probably benign 0.14
R5987:Dnai1 UTSW 4 41,632,391 (GRCm39) missense probably benign 0.03
R6247:Dnai1 UTSW 4 41,605,775 (GRCm39) missense probably benign
R6727:Dnai1 UTSW 4 41,625,308 (GRCm39) missense probably benign
R6874:Dnai1 UTSW 4 41,632,412 (GRCm39) missense probably damaging 1.00
R6914:Dnai1 UTSW 4 41,625,176 (GRCm39) missense probably benign 0.01
R7508:Dnai1 UTSW 4 41,614,323 (GRCm39) missense probably benign 0.01
R7831:Dnai1 UTSW 4 41,614,695 (GRCm39) critical splice donor site probably null
R7832:Dnai1 UTSW 4 41,605,823 (GRCm39) missense probably benign 0.42
R7985:Dnai1 UTSW 4 41,630,055 (GRCm39) missense probably benign
R8065:Dnai1 UTSW 4 41,614,258 (GRCm39) missense probably damaging 1.00
R8067:Dnai1 UTSW 4 41,614,258 (GRCm39) missense probably damaging 1.00
R8234:Dnai1 UTSW 4 41,625,221 (GRCm39) missense probably benign 0.00
R8906:Dnai1 UTSW 4 41,625,125 (GRCm39) missense probably benign 0.00
R9537:Dnai1 UTSW 4 41,629,790 (GRCm39) critical splice acceptor site probably null
R9723:Dnai1 UTSW 4 41,603,302 (GRCm39) missense possibly damaging 0.95
X0065:Dnai1 UTSW 4 41,629,868 (GRCm39) missense possibly damaging 0.89
Z1176:Dnai1 UTSW 4 41,614,323 (GRCm39) missense probably benign 0.32
Z1177:Dnai1 UTSW 4 41,569,809 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCTCATACGTACCATTCAACACTG -3'
(R):5'- TGCATGTTAAATGGAAGGCCATCCTG -3'

Sequencing Primer
(F):5'- caacactgaccaacaaagctac -3'
(R):5'- CCATCCTGGGGTAGTAGCTTAA -3'
Posted On 2013-06-11