Incidental Mutation 'R5697:Vmn1r10'
ID450736
Institutional Source Beutler Lab
Gene Symbol Vmn1r10
Ensembl Gene ENSMUSG00000115181
Gene Namevomeronasal 1 receptor 10
SynonymsV1rc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R5697 (G1)
Quality Score91
Status Not validated
Chromosome6
Chromosomal Location57109454-57115035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57113489 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 22 (L22R)
Ref Sequence ENSEMBL: ENSMUSP00000154213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176073] [ENSMUST00000228270]
Predicted Effect probably damaging
Transcript: ENSMUST00000176073
AA Change: L22R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134901
Gene: ENSMUSG00000115181
AA Change: L22R

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.1e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228270
AA Change: L22R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Vmn1r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Vmn1r10 APN 6 57113836 missense possibly damaging 0.70
IGL03255:Vmn1r10 APN 6 57113926 missense probably benign 0.05
IGL03393:Vmn1r10 APN 6 57114057 nonsense probably null
R0310:Vmn1r10 UTSW 6 57113501 missense probably damaging 0.97
R2271:Vmn1r10 UTSW 6 57114103 missense probably damaging 1.00
R2411:Vmn1r10 UTSW 6 57114139 missense probably benign 0.14
R3700:Vmn1r10 UTSW 6 57114302 missense probably benign 0.05
R3731:Vmn1r10 UTSW 6 57113734 missense probably damaging 0.99
R4805:Vmn1r10 UTSW 6 57113617 missense possibly damaging 0.94
R4922:Vmn1r10 UTSW 6 57113826 missense probably damaging 0.99
R5936:Vmn1r10 UTSW 6 57114317 missense probably benign 0.01
R6119:Vmn1r10 UTSW 6 57114233 missense probably benign 0.01
R7107:Vmn1r10 UTSW 6 57113630 missense possibly damaging 0.90
R7531:Vmn1r10 UTSW 6 57113939 missense possibly damaging 0.90
R7635:Vmn1r10 UTSW 6 57114041 missense probably benign 0.00
R7860:Vmn1r10 UTSW 6 57113701 missense probably benign 0.19
R8786:Vmn1r10 UTSW 6 57114025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGGCTATGATGTACAGTCTGGATC -3'
(R):5'- ACTCAGAAGACAGGTGGTGC -3'

Sequencing Primer
(F):5'- GATGTACAGTCTGGATCATCAAAAG -3'
(R):5'- AGAGGCCTCTCATCACCCTG -3'
Posted On2017-01-03