Incidental Mutation 'R5697:Vmn2r56'
ID450738
Institutional Source Beutler Lab
Gene Symbol Vmn2r56
Ensembl Gene ENSMUSG00000090762
Gene Namevomeronasal 2, receptor 56
SynonymsEG629079
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12693998-12733105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12715990 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 107 (D107G)
Ref Sequence ENSEMBL: ENSMUSP00000129566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163852]
Predicted Effect probably damaging
Transcript: ENSMUST00000163852
AA Change: D107G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129566
Gene: ENSMUSG00000090762
AA Change: D107G

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 1.9e-55 PFAM
Pfam:NCD3G 439 492 6.4e-20 PFAM
Pfam:7tm_3 523 760 1.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Vmn2r56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Vmn2r56 APN 7 12715499 missense probably benign 0.38
IGL01060:Vmn2r56 APN 7 12713089 missense probably damaging 0.97
IGL01433:Vmn2r56 APN 7 12715614 missense probably benign
IGL01859:Vmn2r56 APN 7 12716005 missense probably damaging 1.00
IGL01874:Vmn2r56 APN 7 12715675 missense probably benign 0.03
IGL02208:Vmn2r56 APN 7 12715481 missense probably benign 0.01
PIT4445001:Vmn2r56 UTSW 7 12715226 critical splice donor site probably null
R0077:Vmn2r56 UTSW 7 12715405 missense probably benign 0.01
R0278:Vmn2r56 UTSW 7 12715717 missense probably damaging 0.99
R0512:Vmn2r56 UTSW 7 12715423 missense probably benign
R0658:Vmn2r56 UTSW 7 12710308 missense probably benign 0.10
R0789:Vmn2r56 UTSW 7 12732835 missense probably damaging 1.00
R1534:Vmn2r56 UTSW 7 12694027 missense probably benign
R1731:Vmn2r56 UTSW 7 12733045 missense probably benign
R1817:Vmn2r56 UTSW 7 12715615 missense probably benign
R2047:Vmn2r56 UTSW 7 12732991 missense probably damaging 1.00
R2139:Vmn2r56 UTSW 7 12712963 nonsense probably null
R2160:Vmn2r56 UTSW 7 12694219 missense probably benign 0.43
R2449:Vmn2r56 UTSW 7 12694155 missense possibly damaging 0.67
R2877:Vmn2r56 UTSW 7 12711027 missense probably benign
R2878:Vmn2r56 UTSW 7 12711027 missense probably benign
R4910:Vmn2r56 UTSW 7 12715535 missense possibly damaging 0.64
R5072:Vmn2r56 UTSW 7 12694056 missense probably benign 0.40
R5340:Vmn2r56 UTSW 7 12715872 missense probably damaging 1.00
R5798:Vmn2r56 UTSW 7 12712965 missense probably benign 0.00
R6166:Vmn2r56 UTSW 7 12694020 missense probably damaging 1.00
R6290:Vmn2r56 UTSW 7 12694882 missense probably damaging 1.00
R6458:Vmn2r56 UTSW 7 12694057 missense probably damaging 0.99
R6751:Vmn2r56 UTSW 7 12694792 missense probably benign
R6978:Vmn2r56 UTSW 7 12715406 missense probably benign 0.01
R7090:Vmn2r56 UTSW 7 12715327 missense probably damaging 1.00
R7200:Vmn2r56 UTSW 7 12710332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAATGCAAACCCCAGCTG -3'
(R):5'- GGTAGAACCAGTACCATTCCAAAAG -3'

Sequencing Primer
(F):5'- CTGGGGTTAGCACCTGACTG -3'
(R):5'- CAGATTTCCTGGAGCTAGAGTTACAG -3'
Posted On2017-01-03