Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Ptch2'

45075

Institutional Source

Beutler Lab

Gene Symbol

Ptch2

Ensembl Gene

ENSMUSG00000028681

Gene Name

patched 2

Synonyms

ptc2

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0550 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117096075-117116101 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 117096433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030443] [ENSMUST00000144620]

AlphaFold

O35595

Predicted Effect

probably benign
Transcript: ENSMUST00000030443

SMART Domains

Protein: ENSMUSP00000030443
Gene: ENSMUSG00000028681

Domain	Start	End	E-Value	Type
low complexity region	58	77	N/A	INTRINSIC
low complexity region	251	262	N/A	INTRINSIC
Pfam:Patched	338	831	1.6e-42	PFAM
Pfam:Sterol-sensing	418	570	9.5e-49	PFAM
Pfam:Patched	901	1116	2e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144620

SMART Domains

Protein: ENSMUSP00000122548
Gene: ENSMUSG00000028681

Domain	Start	End	E-Value	Type
low complexity region	58	77	N/A	INTRINSIC
low complexity region	251	262	N/A	INTRINSIC

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: This gene encodes a member of the patched family of transmembrane receptor proteins. The encoded protein may be a functional receptor for the morphogen sonic hedgehog (Shh) and is reportedly involved in limb and skin development. Homozygous mutant mice for this gene exhibit hair loss and epidermal hyperplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Male mice homozygous for a targeted gene disruption display anemia, abnormal red blood cells, enlarged spleens, extramedullary hematopoiesis, and an increased percentage of neutrophils. Most male mice homozygous for another allele display alopecia and skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Ptch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01480:Ptch2	APN	4	117114082	missense	probably damaging	1.00
IGL01684:Ptch2	APN	4	117104787	missense	probably damaging	1.00
IGL01967:Ptch2	APN	4	117114233	splice site	probably benign
IGL02449:Ptch2	APN	4	117108183	missense	possibly damaging	0.79
IGL02488:Ptch2	APN	4	117110396	missense	probably damaging	0.99
IGL02935:Ptch2	APN	4	117114770	missense	probably damaging	1.00
R0103:Ptch2	UTSW	4	117109425	splice site	probably benign
R0326:Ptch2	UTSW	4	117108884	missense	probably damaging	1.00
R0403:Ptch2	UTSW	4	117110839	nonsense	probably null
R0499:Ptch2	UTSW	4	117111143	nonsense	probably null
R0565:Ptch2	UTSW	4	117106143	splice site	probably benign
R1469:Ptch2	UTSW	4	117108465	missense	probably benign
R1469:Ptch2	UTSW	4	117108465	missense	probably benign
R1484:Ptch2	UTSW	4	117110849	missense	probably damaging	0.97
R1920:Ptch2	UTSW	4	117108661	missense	probably benign	0.09
R4080:Ptch2	UTSW	4	117111206	missense	probably damaging	1.00
R4611:Ptch2	UTSW	4	117110378	missense	probably benign	0.24
R5117:Ptch2	UTSW	4	117105949	missense	probably damaging	1.00
R5240:Ptch2	UTSW	4	117106138	splice site	probably benign
R5936:Ptch2	UTSW	4	117108294	missense	probably benign	0.39
R5987:Ptch2	UTSW	4	117110057	missense	probably benign	0.13
R6155:Ptch2	UTSW	4	117096908	missense	probably damaging	1.00
R7158:Ptch2	UTSW	4	117114784	missense	possibly damaging	0.76
R7196:Ptch2	UTSW	4	117114749	missense	probably benign	0.23
R7346:Ptch2	UTSW	4	117114652	missense	probably benign	0.40
R7380:Ptch2	UTSW	4	117114646	missense	possibly damaging	0.92
R7547:Ptch2	UTSW	4	117109964	missense	probably damaging	1.00
R7600:Ptch2	UTSW	4	117096225	start gained	probably benign
R7731:Ptch2	UTSW	4	117108295	missense	probably benign	0.09
R7836:Ptch2	UTSW	4	117105027	splice site	probably null
R7874:Ptch2	UTSW	4	117105964	missense	possibly damaging	0.83
R7881:Ptch2	UTSW	4	117110388	missense	probably benign
R7942:Ptch2	UTSW	4	117106001	missense	probably benign	0.01
R8426:Ptch2	UTSW	4	117108172	missense	possibly damaging	0.84
R8715:Ptch2	UTSW	4	117111522	missense	probably damaging	0.98
R8759:Ptch2	UTSW	4	117110433	missense	probably damaging	0.99
R9082:Ptch2	UTSW	4	117105100	critical splice donor site	probably null
R9276:Ptch2	UTSW	4	117110308	missense	probably damaging	0.97
R9336:Ptch2	UTSW	4	117097000	missense	probably damaging	1.00
R9336:Ptch2	UTSW	4	117109579	missense	possibly damaging	0.89
R9368:Ptch2	UTSW	4	117104772	missense	probably damaging	0.98
X0019:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0024:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0025:Ptch2	UTSW	4	117096986	missense	probably damaging	1.00
X0035:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0038:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0039:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0040:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0052:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0053:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0054:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64
X0061:Ptch2	UTSW	4	117109867	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- AGATCCACAGTCGCCACCTTTAGC -3'
(R):5'- GTGCCTTCTCCATAAGCACACCTG -3'

Sequencing Primer
(F):5'- TTCACGGCAGCTAGGAATC -3'
(R):5'- ACACACTCGTTGTCAGCTAGG -3'

Posted On

2013-06-11