Incidental Mutation 'R5697:Actr8'
ID450755
Institutional Source Beutler Lab
Gene Symbol Actr8
Ensembl Gene ENSMUSG00000015971
Gene NameARP8 actin-related protein 8
Synonyms5730542K05Rik, ARP8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location29978337-30006354 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29991673 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 550 (F550S)
Ref Sequence ENSEMBL: ENSMUSP00000153076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000016115] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
Predicted Effect probably benign
Transcript: ENSMUST00000016110
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000016115
AA Change: F550S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: F550S

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122205
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135888
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136726
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224067
Predicted Effect possibly damaging
Transcript: ENSMUST00000224797
AA Change: F550S

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225368
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Actr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Actr8 APN 14 29988335 missense probably damaging 1.00
IGL01449:Actr8 APN 14 29990970 critical splice donor site probably null
IGL01577:Actr8 APN 14 29987275 missense probably benign
IGL02118:Actr8 APN 14 29982771 critical splice donor site probably null
IGL02647:Actr8 APN 14 29990890 missense probably damaging 1.00
IGL02659:Actr8 APN 14 29986341 missense probably damaging 1.00
IGL02696:Actr8 APN 14 29982671 missense probably benign 0.33
IGL03015:Actr8 APN 14 29986316 missense possibly damaging 0.81
IGL03335:Actr8 APN 14 29978557 missense probably benign
R0512:Actr8 UTSW 14 29978556 missense probably benign 0.00
R0735:Actr8 UTSW 14 29989712 missense probably benign 0.02
R0926:Actr8 UTSW 14 29987224 missense probably benign 0.02
R1443:Actr8 UTSW 14 29984099 missense possibly damaging 0.73
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1616:Actr8 UTSW 14 29982644 missense possibly damaging 0.53
R2097:Actr8 UTSW 14 29987228 missense probably damaging 0.98
R2240:Actr8 UTSW 14 29989757 missense possibly damaging 0.94
R2570:Actr8 UTSW 14 29987282 missense probably damaging 1.00
R5122:Actr8 UTSW 14 29982715 missense possibly damaging 0.95
R5439:Actr8 UTSW 14 29986995 missense probably damaging 1.00
R5727:Actr8 UTSW 14 29990881 missense probably benign 0.01
R5860:Actr8 UTSW 14 29986285 nonsense probably null
R5988:Actr8 UTSW 14 29993073 missense possibly damaging 0.71
R6006:Actr8 UTSW 14 29984142 critical splice donor site probably null
R6009:Actr8 UTSW 14 29978497 unclassified probably benign
R6155:Actr8 UTSW 14 29978589 critical splice donor site probably null
R6190:Actr8 UTSW 14 29991717 nonsense probably null
R6329:Actr8 UTSW 14 29993084 nonsense probably null
R6483:Actr8 UTSW 14 29978581 missense possibly damaging 0.53
R6517:Actr8 UTSW 14 29982716 nonsense probably null
R6562:Actr8 UTSW 14 29986454 splice site probably null
R7484:Actr8 UTSW 14 29992968 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29986401 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29987242 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGGGGCAGATCCTAGAG -3'
(R):5'- CCCACTGAAAGTCATGTTCACATTTC -3'

Sequencing Primer
(F):5'- CCTAGAGGATGCTGGGTTGTTTAAG -3'
(R):5'- TCTAGGTCCTCGACACTCACAG -3'
Posted On2017-01-03