Incidental Mutation 'R5697:Pias2'
ID450757
Institutional Source Beutler Lab
Gene Symbol Pias2
Ensembl Gene ENSMUSG00000025423
Gene Nameprotein inhibitor of activated STAT 2
SynonymsARIP3, Miz1, PIASxalpha, PIASxbeta, Dib, 6330408K17Rik, PIASxb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77065208-77155708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77133188 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 373 (K373R)
Ref Sequence ENSEMBL: ENSMUSP00000131485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114776] [ENSMUST00000114777] [ENSMUST00000168882]
Predicted Effect probably benign
Transcript: ENSMUST00000114776
AA Change: K373R

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110424
Gene: ENSMUSG00000025423
AA Change: K373R

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 7e-45 PFAM
Pfam:zf-MIZ 335 384 4.9e-24 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114777
AA Change: K380R

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110425
Gene: ENSMUSG00000025423
AA Change: K380R

DomainStartEndE-ValueType
SAP 11 45 2.01e-5 SMART
low complexity region 102 117 N/A INTRINSIC
low complexity region 135 144 N/A INTRINSIC
Pfam:PINIT 145 297 4.8e-38 PFAM
Pfam:zf-MIZ 342 391 1.7e-24 PFAM
low complexity region 475 483 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 571 610 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168882
AA Change: K373R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131485
Gene: ENSMUSG00000025423
AA Change: K373R

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 2.3e-44 PFAM
Pfam:zf-MIZ 335 384 2.6e-23 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
low complexity region 564 603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Isoforms of the encoded protein enhance the sumoylation of specific target proteins including the p53 tumor suppressor protein, c-Jun, and the androgen receptor. A pseudogene of this gene is located on the short arm of chromosome 4. The symbol MIZ1 has also been associated with ZBTB17 which is a different gene located on chromosome 1. [provided by RefSeq, Aug 2011]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype although abnormalities are reported in the testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Pias2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Pias2 APN 18 77133211 missense probably damaging 1.00
IGL01105:Pias2 APN 18 77133156 missense probably damaging 1.00
IGL02379:Pias2 APN 18 77145148 splice site probably benign
IGL02932:Pias2 APN 18 77145103 missense probably damaging 1.00
IGL03181:Pias2 APN 18 77133242 missense possibly damaging 0.83
IGL03389:Pias2 APN 18 77097658 missense probably damaging 1.00
IGL03138:Pias2 UTSW 18 77150100 critical splice donor site probably null
R0492:Pias2 UTSW 18 77105885 missense probably damaging 1.00
R0577:Pias2 UTSW 18 77097281 missense probably damaging 1.00
R1660:Pias2 UTSW 18 77120129 missense probably damaging 1.00
R1866:Pias2 UTSW 18 77152716 missense probably benign 0.03
R1901:Pias2 UTSW 18 77097443 nonsense probably null
R1996:Pias2 UTSW 18 77129063 critical splice donor site probably null
R2107:Pias2 UTSW 18 77097471 missense probably benign 0.35
R4439:Pias2 UTSW 18 77097703 missense probably damaging 1.00
R4603:Pias2 UTSW 18 77130107 missense probably damaging 0.99
R4747:Pias2 UTSW 18 77152792 makesense probably null
R4816:Pias2 UTSW 18 77105891 critical splice donor site probably null
R6265:Pias2 UTSW 18 77097258 missense probably damaging 1.00
R6375:Pias2 UTSW 18 77152670 missense possibly damaging 0.96
R6545:Pias2 UTSW 18 77130085 missense possibly damaging 0.61
R6713:Pias2 UTSW 18 77065720 utr 5 prime probably null
R7193:Pias2 UTSW 18 77120121 missense possibly damaging 0.76
R7232:Pias2 UTSW 18 77133235 missense probably benign 0.02
R7253:Pias2 UTSW 18 77120115 missense probably damaging 0.97
R7259:Pias2 UTSW 18 77152720 missense possibly damaging 0.73
X0009:Pias2 UTSW 18 77145097 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAGCACCTTTTCTCCTGTAGG -3'
(R):5'- ACAGCTTCAAACTTAGCACCTATG -3'

Sequencing Primer
(F):5'- GTAGGTTCTCTTGTCCTATTTGAAC -3'
(R):5'- ACTTGACTCTGTCTCCTGAGTGATAG -3'
Posted On2017-01-03