Incidental Mutation 'R5698:Irs1'
ID450760
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82288734 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 587 (H587R)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect probably benign
Transcript: ENSMUST00000069799
AA Change: H587R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: H587R

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7962:Irs1 UTSW 1 82288722 missense possibly damaging 0.57
R8139:Irs1 UTSW 1 82289739 missense probably damaging 1.00
R8158:Irs1 UTSW 1 82289533 missense probably damaging 1.00
R8159:Irs1 UTSW 1 82288569 missense probably damaging 1.00
R8187:Irs1 UTSW 1 82288300 missense probably damaging 1.00
R8288:Irs1 UTSW 1 82287961 nonsense probably null
R8436:Irs1 UTSW 1 82290249 missense possibly damaging 0.96
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense possibly damaging 0.87
Z1177:Irs1 UTSW 1 82290394 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCATGTAGCCATTGGGGTCC -3'
(R):5'- TCCTACCATTTCCCATCAGAAG -3'

Sequencing Primer
(F):5'- GTAGCCATTGGGGTCCACTCTC -3'
(R):5'- GACCCCCTCACAGTCTTCAGTG -3'
Posted On2017-01-03