Incidental Mutation 'R5698:Ccnt2'
ID450761
Institutional Source Beutler Lab
Gene Symbol Ccnt2
Ensembl Gene ENSMUSG00000026349
Gene Namecyclin T2
Synonyms2900041I18Rik, CycT2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127774164-127808061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127803228 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 614 (K614R)
Ref Sequence ENSEMBL: ENSMUSP00000108189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027587] [ENSMUST00000112570]
Predicted Effect probably benign
Transcript: ENSMUST00000027587
AA Change: K614R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027587
Gene: ENSMUSG00000026349
AA Change: K614R

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 653 N/A INTRINSIC
low complexity region 658 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112570
AA Change: K614R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108189
Gene: ENSMUSG00000026349
AA Change: K614R

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153359
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin and its kinase partner CDK9 were found to be subunits of the transcription elongation factor p-TEFb. The p-TEFb complex containing this cyclin was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 (HIV-1) Tat protein. A pseudogene of this gene is found on chromosome 1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to the 4-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Ccnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ccnt2 APN 1 127797891 splice site probably benign
IGL01370:Ccnt2 APN 1 127803513 missense possibly damaging 0.49
IGL02055:Ccnt2 APN 1 127791710 missense possibly damaging 0.46
IGL02169:Ccnt2 APN 1 127774389 splice site probably benign
R0526:Ccnt2 UTSW 1 127799445 missense probably damaging 1.00
R0538:Ccnt2 UTSW 1 127803165 missense probably damaging 0.98
R0744:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0833:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0836:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R1763:Ccnt2 UTSW 1 127799406 missense possibly damaging 0.94
R2037:Ccnt2 UTSW 1 127803399 missense probably damaging 1.00
R2159:Ccnt2 UTSW 1 127775154 missense probably benign 0.00
R4585:Ccnt2 UTSW 1 127803029 missense probably damaging 0.99
R5342:Ccnt2 UTSW 1 127791733 splice site silent
R5527:Ccnt2 UTSW 1 127802664 missense probably benign 0.00
R6606:Ccnt2 UTSW 1 127803241 missense probably benign 0.00
R6821:Ccnt2 UTSW 1 127803335 missense probably damaging 0.99
R6979:Ccnt2 UTSW 1 127775136 missense probably damaging 0.97
R7512:Ccnt2 UTSW 1 127802294 missense possibly damaging 0.85
R8743:Ccnt2 UTSW 1 127774283 missense probably damaging 1.00
X0019:Ccnt2 UTSW 1 127775140 missense probably damaging 1.00
X0027:Ccnt2 UTSW 1 127774288 missense probably damaging 0.98
Z1177:Ccnt2 UTSW 1 127803058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGAAAGACACAGCTCTTC -3'
(R):5'- TAGCCCACCTGGTATGTGAC -3'

Sequencing Primer
(F):5'- TCGGAAAGACACAGCTCTTCTGATG -3'
(R):5'- CACCTGGTATGTGACAGGGG -3'
Posted On2017-01-03