Incidental Mutation 'R5698:Copa'
ID 450762
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Name coatomer protein complex subunit alpha
Synonyms xenin
Accession Numbers

Genbank: NM_009938; MGI: 1334462
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R5698 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 172082529-172122330 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 172118944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 976 (L976*)
Ref Sequence ENSEMBL: ENSMUSP00000118179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]
AlphaFold Q8CIE6
Predicted Effect probably null
Transcript: ENSMUST00000027833
AA Change: L985*
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: L985*

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133909
Predicted Effect probably null
Transcript: ENSMUST00000135192
AA Change: L976*
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: L976*

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142765
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 splice site probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R0628:Copa UTSW 1 172091025 splice site probably benign
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R3975:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4711:Copa UTSW 1 172119988 missense probably damaging 1.00
R4721:Copa UTSW 1 172104274 splice site probably benign
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5139:Copa UTSW 1 172121329 missense probably damaging 0.99
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
R7348:Copa UTSW 1 172102223 missense possibly damaging 0.96
R7710:Copa UTSW 1 172109844 missense possibly damaging 0.50
R7745:Copa UTSW 1 172111942 missense probably damaging 1.00
R7893:Copa UTSW 1 172119565 nonsense probably null
R8168:Copa UTSW 1 172099672 missense probably damaging 1.00
R8273:Copa UTSW 1 172118979 critical splice donor site probably null
R8704:Copa UTSW 1 172104126 missense probably benign 0.01
R8754:Copa UTSW 1 172108359 missense probably damaging 1.00
R8757:Copa UTSW 1 172119514 missense probably benign 0.04
R8759:Copa UTSW 1 172119514 missense probably benign 0.04
R8885:Copa UTSW 1 172097745 missense probably damaging 1.00
R8891:Copa UTSW 1 172119251 missense probably damaging 1.00
R8927:Copa UTSW 1 172104170 missense probably null 0.03
R8928:Copa UTSW 1 172104170 missense probably null 0.03
R8956:Copa UTSW 1 172109913 missense possibly damaging 0.65
R9063:Copa UTSW 1 172116962 missense probably benign 0.00
R9295:Copa UTSW 1 172112256 missense probably damaging 0.99
R9364:Copa UTSW 1 172117264 missense probably benign 0.00
R9437:Copa UTSW 1 172104145 missense possibly damaging 0.93
R9673:Copa UTSW 1 172118081 missense probably benign 0.11
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Z1177:Copa UTSW 1 172106123 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGATCACTTGCTGTCACTCG -3'
(R):5'- GTCACCAACCCACTACTGTG -3'

Sequencing Primer
(F):5'- GGTTACTCTGAAGTACTCTCTATAGG -3'
(R):5'- CTACTGTGGGAATAACTGGAAATAGG -3'
Posted On 2017-01-03