Incidental Mutation 'R5698:Zswim2'
ID450768
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Namezinc finger SWIM-type containing 2
Synonyms4933437F18Rik, MEX, 1700025P14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location83915079-83941228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83925183 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 125 (D125Y)
Ref Sequence ENSEMBL: ENSMUSP00000119439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038223
AA Change: D125Y

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: D125Y

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152829
AA Change: D125Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552
AA Change: D125Y

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155127
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83923771 missense probably benign 0.00
IGL01140:Zswim2 APN 2 83915328 missense probably benign 0.06
IGL01362:Zswim2 APN 2 83915346 missense probably benign 0.09
IGL01768:Zswim2 APN 2 83917957 missense probably benign 0.00
IGL02166:Zswim2 APN 2 83915406 nonsense probably null
IGL02187:Zswim2 APN 2 83923638 missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83938763 nonsense probably null
IGL02629:Zswim2 APN 2 83925209 missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83923659 missense probably benign 0.02
R0943:Zswim2 UTSW 2 83917998 missense possibly damaging 0.88
R0946:Zswim2 UTSW 2 83923759 missense probably benign 0.10
R1006:Zswim2 UTSW 2 83915393 missense probably damaging 0.97
R1191:Zswim2 UTSW 2 83923695 missense possibly damaging 0.60
R1309:Zswim2 UTSW 2 83938756 missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83923748 missense probably benign 0.24
R1563:Zswim2 UTSW 2 83915282 missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83915340 nonsense probably null
R1994:Zswim2 UTSW 2 83915663 missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83915994 missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83915547 missense probably benign 0.00
R4738:Zswim2 UTSW 2 83915395 missense probably benign 0.16
R4855:Zswim2 UTSW 2 83916843 critical splice donor site probably null
R4933:Zswim2 UTSW 2 83925227 missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83925110 missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83939666 missense possibly damaging 0.75
R5401:Zswim2 UTSW 2 83925245 missense possibly damaging 0.94
R6002:Zswim2 UTSW 2 83915688 missense probably damaging 0.98
R6396:Zswim2 UTSW 2 83923718 missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83915113 splice site probably null
R6646:Zswim2 UTSW 2 83915784 nonsense probably null
R6717:Zswim2 UTSW 2 83915409 missense probably benign 0.02
R6735:Zswim2 UTSW 2 83923761 missense probably benign 0.04
R6830:Zswim2 UTSW 2 83939684 missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83920748 critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83915727 nonsense probably null
R7383:Zswim2 UTSW 2 83915328 missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83920719 missense probably damaging 1.00
R7747:Zswim2 UTSW 2 83915607 missense probably damaging 0.97
R7955:Zswim2 UTSW 2 83916883 missense probably benign 0.00
R7983:Zswim2 UTSW 2 83923567 critical splice donor site probably null
R8765:Zswim2 UTSW 2 83941087 missense probably damaging 1.00
X0018:Zswim2 UTSW 2 83941094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAATTTCATGATGGAACTTCCTAGG -3'
(R):5'- ACAGTCCACCTGGTACTATCTC -3'

Sequencing Primer
(F):5'- GAGTTTTTTCTCCAGCAGC -3'
(R):5'- ACCTGGTACTATCTCTCTCATATTTG -3'
Posted On2017-01-03