Incidental Mutation 'R5698:Zswim2'
ID 450768
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Name zinc finger SWIM-type containing 2
Synonyms 4933437F18Rik, MEX, 1700025P14Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5698 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 83745423-83771572 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 83755527 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 125 (D125Y)
Ref Sequence ENSEMBL: ENSMUSP00000119439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
AlphaFold Q9D9X6
Predicted Effect possibly damaging
Transcript: ENSMUST00000038223
AA Change: D125Y

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: D125Y

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152829
AA Change: D125Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552
AA Change: D125Y

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155127
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,926,366 (GRCm39) K334E possibly damaging Het
Ache G A 5: 137,288,821 (GRCm39) V176M probably damaging Het
Acss3 T C 10: 106,784,605 (GRCm39) D539G probably damaging Het
Adam6b T A 12: 113,455,083 (GRCm39) D633E probably benign Het
Aldh16a1 G A 7: 44,803,831 (GRCm39) probably benign Het
Amigo2 G A 15: 97,143,607 (GRCm39) Q272* probably null Het
Aoc1l1 A G 6: 48,953,256 (GRCm39) T394A possibly damaging Het
Appbp2 A T 11: 85,100,925 (GRCm39) H171Q probably damaging Het
Arhgef18 A G 8: 3,489,499 (GRCm39) D277G probably damaging Het
Armc8 A G 9: 99,417,873 (GRCm39) V95A probably benign Het
Atp6v0a4 C T 6: 38,027,442 (GRCm39) probably null Het
Atp8a1 A T 5: 67,924,496 (GRCm39) N289K probably benign Het
Cand2 C T 6: 115,768,704 (GRCm39) L505F probably damaging Het
Ccnt2 A G 1: 127,730,965 (GRCm39) K614R probably benign Het
Col25a1 A G 3: 130,272,632 (GRCm39) probably null Het
Copa T A 1: 171,946,511 (GRCm39) L976* probably null Het
Ddx39b T C 17: 35,470,287 (GRCm39) V267A probably benign Het
Dpp4 T A 2: 62,164,655 (GRCm39) Q709L probably damaging Het
Eno4 A G 19: 58,956,904 (GRCm39) probably null Het
Exoc3 A G 13: 74,322,134 (GRCm39) L647P probably benign Het
Eya4 T C 10: 23,015,975 (GRCm39) S308G possibly damaging Het
Fbxo41 T C 6: 85,454,638 (GRCm39) T693A possibly damaging Het
Fcgbp A G 7: 27,791,447 (GRCm39) T903A possibly damaging Het
Fkbp10 G T 11: 100,314,352 (GRCm39) W384L probably damaging Het
Frem2 A G 3: 53,559,926 (GRCm39) I1527T possibly damaging Het
H13 T A 2: 152,530,875 (GRCm39) I220N probably damaging Het
Has2 T C 15: 56,531,312 (GRCm39) R468G probably damaging Het
Ighmbp2 A G 19: 3,324,538 (GRCm39) S243P probably damaging Het
Irs1 T C 1: 82,266,455 (GRCm39) H587R probably benign Het
Kcnk1 C T 8: 126,752,144 (GRCm39) T250M probably damaging Het
Kif9 T C 9: 110,339,532 (GRCm39) V458A probably benign Het
Krt14 T C 11: 100,096,451 (GRCm39) T208A probably benign Het
Mybpc3 C A 2: 90,955,194 (GRCm39) H349Q possibly damaging Het
Neurl3 T A 1: 36,305,587 (GRCm39) T207S possibly damaging Het
Nol9 T C 4: 152,135,031 (GRCm39) V388A probably damaging Het
Notch3 T C 17: 32,376,961 (GRCm39) N315D probably damaging Het
Oas1h G T 5: 121,009,045 (GRCm39) A252S probably damaging Het
Or13c7b C A 4: 43,821,183 (GRCm39) M59I probably damaging Het
Pcbp1 G A 6: 86,502,134 (GRCm39) T255M possibly damaging Het
Plec A G 15: 76,083,808 (GRCm39) V18A probably benign Het
Ppp1r17 A T 6: 56,003,529 (GRCm39) E114V probably damaging Het
Scamp5 A T 9: 57,352,716 (GRCm39) M151K possibly damaging Het
Sestd1 T C 2: 77,048,512 (GRCm39) Y135C possibly damaging Het
Slc22a21 T G 11: 53,842,175 (GRCm39) K534N probably benign Het
Slc25a12 T C 2: 71,112,917 (GRCm39) E448G probably damaging Het
Slco3a1 A G 7: 73,996,566 (GRCm39) L280P probably damaging Het
Sppl2b C A 10: 80,701,879 (GRCm39) probably null Het
Srd5a2 T C 17: 74,334,014 (GRCm39) E135G possibly damaging Het
Tfg A T 16: 56,521,467 (GRCm39) M183K probably damaging Het
Ticrr G A 7: 79,328,881 (GRCm39) M673I probably benign Het
Tm4sf20 T G 1: 82,745,958 (GRCm39) M61L probably benign Het
Ttll8 A T 15: 88,823,209 (GRCm39) S85T possibly damaging Het
Uggt2 G A 14: 119,280,138 (GRCm39) S780F probably damaging Het
Uroc1 T C 6: 90,324,302 (GRCm39) L442P probably damaging Het
Zfp1005 C T 2: 150,111,394 (GRCm39) H695Y possibly damaging Het
Znrf3 A G 11: 5,239,006 (GRCm39) probably benign Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83,754,115 (GRCm39) missense probably benign 0.00
IGL01140:Zswim2 APN 2 83,745,672 (GRCm39) missense probably benign 0.06
IGL01362:Zswim2 APN 2 83,745,690 (GRCm39) missense probably benign 0.09
IGL01768:Zswim2 APN 2 83,748,301 (GRCm39) missense probably benign 0.00
IGL02166:Zswim2 APN 2 83,745,750 (GRCm39) nonsense probably null
IGL02187:Zswim2 APN 2 83,753,982 (GRCm39) missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83,769,107 (GRCm39) nonsense probably null
IGL02629:Zswim2 APN 2 83,755,553 (GRCm39) missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83,754,003 (GRCm39) missense probably benign 0.02
R0943:Zswim2 UTSW 2 83,748,342 (GRCm39) missense possibly damaging 0.88
R0946:Zswim2 UTSW 2 83,754,103 (GRCm39) missense probably benign 0.10
R1006:Zswim2 UTSW 2 83,745,737 (GRCm39) missense probably damaging 0.97
R1191:Zswim2 UTSW 2 83,754,039 (GRCm39) missense possibly damaging 0.60
R1309:Zswim2 UTSW 2 83,769,100 (GRCm39) missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83,754,092 (GRCm39) missense probably benign 0.24
R1563:Zswim2 UTSW 2 83,745,626 (GRCm39) missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83,745,684 (GRCm39) nonsense probably null
R1994:Zswim2 UTSW 2 83,746,007 (GRCm39) missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83,746,338 (GRCm39) missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83,745,891 (GRCm39) missense probably benign 0.00
R4738:Zswim2 UTSW 2 83,745,739 (GRCm39) missense probably benign 0.16
R4855:Zswim2 UTSW 2 83,747,187 (GRCm39) critical splice donor site probably null
R4933:Zswim2 UTSW 2 83,755,571 (GRCm39) missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83,755,454 (GRCm39) missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83,770,010 (GRCm39) missense possibly damaging 0.75
R5401:Zswim2 UTSW 2 83,755,589 (GRCm39) missense possibly damaging 0.94
R6002:Zswim2 UTSW 2 83,746,032 (GRCm39) missense probably damaging 0.98
R6396:Zswim2 UTSW 2 83,754,062 (GRCm39) missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83,745,457 (GRCm39) splice site probably null
R6646:Zswim2 UTSW 2 83,746,128 (GRCm39) nonsense probably null
R6717:Zswim2 UTSW 2 83,745,753 (GRCm39) missense probably benign 0.02
R6735:Zswim2 UTSW 2 83,754,105 (GRCm39) missense probably benign 0.04
R6830:Zswim2 UTSW 2 83,770,028 (GRCm39) missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83,751,092 (GRCm39) critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83,746,071 (GRCm39) nonsense probably null
R7383:Zswim2 UTSW 2 83,745,672 (GRCm39) missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83,751,063 (GRCm39) missense probably damaging 1.00
R7747:Zswim2 UTSW 2 83,745,951 (GRCm39) missense probably damaging 0.97
R7955:Zswim2 UTSW 2 83,747,227 (GRCm39) missense probably benign 0.00
R7983:Zswim2 UTSW 2 83,753,911 (GRCm39) critical splice donor site probably null
R8765:Zswim2 UTSW 2 83,771,431 (GRCm39) missense probably damaging 1.00
R9295:Zswim2 UTSW 2 83,748,304 (GRCm39) missense probably benign 0.00
R9465:Zswim2 UTSW 2 83,746,275 (GRCm39) missense probably benign 0.21
X0018:Zswim2 UTSW 2 83,771,438 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAATTTCATGATGGAACTTCCTAGG -3'
(R):5'- ACAGTCCACCTGGTACTATCTC -3'

Sequencing Primer
(F):5'- GAGTTTTTTCTCCAGCAGC -3'
(R):5'- ACCTGGTACTATCTCTCTCATATTTG -3'
Posted On 2017-01-03