Incidental Mutation 'R5698:Mybpc3'
ID450769
Institutional Source Beutler Lab
Gene Symbol Mybpc3
Ensembl Gene ENSMUSG00000002100
Gene Namemyosin binding protein C, cardiac
Synonymscardiac C-protein
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91118144-91136516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91124849 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 349 (H349Q)
Ref Sequence ENSEMBL: ENSMUSP00000119994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111430] [ENSMUST00000137942] [ENSMUST00000169776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111430
AA Change: H513Q

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100
AA Change: H513Q

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137942
AA Change: H349Q

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100
AA Change: H349Q

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169776
AA Change: H514Q

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100
AA Change: H514Q

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null or truncated mutations exhibit cardiac abnormalities such as cardiac hypertrophy, dilated cardiomyopathy, abnormal cardiac muscle contractility and relaxation, disorganized myocardium, and cardiac fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Mybpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mybpc3 APN 2 91120029 missense probably benign
IGL00985:Mybpc3 APN 2 91135359 missense probably benign 0.16
IGL01926:Mybpc3 APN 2 91135407 missense possibly damaging 0.61
IGL02135:Mybpc3 APN 2 91124826 missense possibly damaging 0.58
IGL02187:Mybpc3 APN 2 91135452 missense probably benign
IGL02219:Mybpc3 APN 2 91121023 critical splice acceptor site probably null
IGL02752:Mybpc3 APN 2 91132637 critical splice acceptor site probably null
IGL03002:Mybpc3 APN 2 91123889 missense probably damaging 1.00
IGL03118:Mybpc3 APN 2 91124503 missense probably damaging 1.00
IGL03238:Mybpc3 APN 2 91131659 missense probably damaging 1.00
R0010:Mybpc3 UTSW 2 91134833 nonsense probably null
R0114:Mybpc3 UTSW 2 91124494 missense probably damaging 1.00
R0139:Mybpc3 UTSW 2 91120337 splice site probably benign
R0282:Mybpc3 UTSW 2 91124024 splice site probably benign
R0673:Mybpc3 UTSW 2 91120427 missense probably damaging 1.00
R1388:Mybpc3 UTSW 2 91122874 missense probably benign 0.43
R2159:Mybpc3 UTSW 2 91125370 missense probably damaging 1.00
R2424:Mybpc3 UTSW 2 91135793 missense probably benign 0.20
R3983:Mybpc3 UTSW 2 91135369 missense probably benign
R4322:Mybpc3 UTSW 2 91123961 missense possibly damaging 0.87
R4909:Mybpc3 UTSW 2 91134812 missense probably benign
R4913:Mybpc3 UTSW 2 91126264 missense possibly damaging 0.46
R4965:Mybpc3 UTSW 2 91119247 missense possibly damaging 0.50
R5248:Mybpc3 UTSW 2 91125228 intron probably null
R5311:Mybpc3 UTSW 2 91128678 nonsense probably null
R5332:Mybpc3 UTSW 2 91122938 missense probably damaging 1.00
R5635:Mybpc3 UTSW 2 91134829 missense probably benign 0.00
R5647:Mybpc3 UTSW 2 91121722 splice site probably null
R5832:Mybpc3 UTSW 2 91119175 splice site probably null
R5895:Mybpc3 UTSW 2 91124665 missense probably damaging 0.99
R6833:Mybpc3 UTSW 2 91125428 splice site probably null
R7061:Mybpc3 UTSW 2 91125404 missense possibly damaging 0.93
R7144:Mybpc3 UTSW 2 91134604 missense probably benign 0.03
R7169:Mybpc3 UTSW 2 91118179 missense possibly damaging 0.85
R7472:Mybpc3 UTSW 2 91131656 missense probably damaging 1.00
R7538:Mybpc3 UTSW 2 91120487 missense probably damaging 1.00
R7677:Mybpc3 UTSW 2 91129031 missense probably benign 0.04
Z1088:Mybpc3 UTSW 2 91135359 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCCAAGTCAAATGGTGAGG -3'
(R):5'- GACCTCCTAACACTCTCTGCAG -3'

Sequencing Primer
(F):5'- TCAAATGGTGAGGGCAGGAGC -3'
(R):5'- TGCAGGGTATACTTCAGCATACC -3'
Posted On2017-01-03