Incidental Mutation 'R5698:H13'
ID450771
Institutional Source Beutler Lab
Gene Symbol H13
Ensembl Gene ENSMUSG00000019188
Gene Namehistocompatibility 13
SynonymsSpp, 1200006O09Rik, H-13, 5031424B04Rik, 4930443L17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152669461-152708670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152688955 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 220 (I220N)
Ref Sequence ENSEMBL: ENSMUSP00000120068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062148] [ENSMUST00000079247] [ENSMUST00000089059] [ENSMUST00000109825] [ENSMUST00000125366]
Predicted Effect probably benign
Transcript: ENSMUST00000062148
SMART Domains Protein: ENSMUSP00000100534
Gene: ENSMUSG00000042814

DomainStartEndE-ValueType
Blast:PSN 40 63 9e-7 BLAST
PUA 93 171 3.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079247
SMART Domains Protein: ENSMUSP00000078236
Gene: ENSMUSG00000019188

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
PSN 66 295 1.74e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089059
AA Change: I220N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086460
Gene: ENSMUSG00000019188
AA Change: I220N

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109825
SMART Domains Protein: ENSMUSP00000105450
Gene: ENSMUSG00000019188

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:Peptidase_A22B 62 174 3.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125366
AA Change: I220N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120068
Gene: ENSMUSG00000019188
AA Change: I220N

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
PSN 66 337 1.56e-119 SMART
low complexity region 355 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129439
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: This is one of several loci identified by development of congenic strains differing in resistance to transplantable tumors. C57BL/10 carries the a allele and B10.129(14M) carries the b allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in H13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:H13 APN 2 152688682 missense probably damaging 0.98
R0100:H13 UTSW 2 152689863 splice site probably null
R0100:H13 UTSW 2 152689863 splice site probably null
R0106:H13 UTSW 2 152686256 missense probably benign 0.09
R0178:H13 UTSW 2 152681067 missense probably damaging 1.00
R2880:H13 UTSW 2 152695561 missense probably damaging 1.00
R4058:H13 UTSW 2 152691874 missense probably damaging 1.00
R4110:H13 UTSW 2 152681109 missense probably damaging 0.99
R4397:H13 UTSW 2 152677552 missense probably damaging 0.98
R7145:H13 UTSW 2 152681072 missense probably damaging 1.00
R7773:H13 UTSW 2 152695511 missense probably damaging 1.00
R8116:H13 UTSW 2 152695526 missense probably damaging 1.00
R8192:H13 UTSW 2 152669602 missense probably benign
R8362:H13 UTSW 2 152686391 missense unknown
R8409:H13 UTSW 2 152689893 missense possibly damaging 0.94
R8891:H13 UTSW 2 152704129 missense probably benign
RF005:H13 UTSW 2 152669669 missense probably damaging 1.00
RF008:H13 UTSW 2 152669669 missense probably damaging 1.00
RF016:H13 UTSW 2 152669669 missense probably damaging 1.00
RF019:H13 UTSW 2 152669669 missense probably damaging 1.00
RF023:H13 UTSW 2 152669669 missense probably damaging 1.00
RF024:H13 UTSW 2 152669669 missense probably damaging 1.00
X0019:H13 UTSW 2 152681070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTAAGTCAGAGCCTGCG -3'
(R):5'- AAAGCACTGGGTACTCTGGG -3'

Sequencing Primer
(F):5'- TCAGAGCCTGCGCAGAAG -3'
(R):5'- CACTGGGTACTCTGGGTTCTTG -3'
Posted On2017-01-03