Incidental Mutation 'R5698:Col25a1'
ID450774
Institutional Source Beutler Lab
Gene Symbol Col25a1
Ensembl Gene ENSMUSG00000058897
Gene Namecollagen, type XXV, alpha 1
Synonyms2700062B08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location130131501-130599877 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 130478983 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080335] [ENSMUST00000106353] [ENSMUST00000106353] [ENSMUST00000183368]
Predicted Effect probably null
Transcript: ENSMUST00000080335
SMART Domains Protein: ENSMUSP00000079210
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 7e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
Pfam:Collagen 311 374 5.4e-11 PFAM
Pfam:Collagen 368 427 2e-9 PFAM
Pfam:Collagen 447 504 1.6e-10 PFAM
Pfam:Collagen 494 561 3.3e-8 PFAM
Pfam:Collagen 586 660 4.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106353
SMART Domains Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 174 1.7e-11 PFAM
Pfam:Collagen 183 244 6.2e-12 PFAM
Pfam:Collagen 233 297 7.5e-11 PFAM
Pfam:Collagen 294 345 1.8e-9 PFAM
Pfam:Collagen 343 399 1.1e-10 PFAM
Pfam:Collagen 419 475 1.9e-10 PFAM
low complexity region 490 525 N/A INTRINSIC
Pfam:Collagen 555 622 6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106353
SMART Domains Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 174 1.7e-11 PFAM
Pfam:Collagen 183 244 6.2e-12 PFAM
Pfam:Collagen 233 297 7.5e-11 PFAM
Pfam:Collagen 294 345 1.8e-9 PFAM
Pfam:Collagen 343 399 1.1e-10 PFAM
Pfam:Collagen 419 475 1.9e-10 PFAM
low complexity region 490 525 N/A INTRINSIC
Pfam:Collagen 555 622 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143830
Predicted Effect probably benign
Transcript: ENSMUST00000183368
SMART Domains Protein: ENSMUSP00000138875
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 6.8e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
internal_repeat_2 249 294 2.8e-5 PROSPERO
internal_repeat_1 294 308 4.06e-8 PROSPERO
Pfam:Collagen 309 372 2.1e-11 PFAM
Pfam:Collagen 371 427 3.7e-10 PFAM
Pfam:Collagen 447 496 7.7e-10 PFAM
low complexity region 497 506 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198205
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cyanosis and abnormal body curvature with apoptosis of phrenic nerve motor neurons and failure of diaphragm innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Col25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col25a1 APN 3 130181784 splice site probably benign
IGL00570:Col25a1 APN 3 130546432 splice site probably benign
IGL01651:Col25a1 APN 3 130566485 missense probably benign 0.06
IGL02033:Col25a1 APN 3 130388948 splice site probably benign
IGL02117:Col25a1 APN 3 130519773 splice site probably benign
IGL02290:Col25a1 APN 3 130519811 splice site probably benign
IGL03135:Col25a1 APN 3 130529683 splice site probably benign
R0526:Col25a1 UTSW 3 130476394 missense probably damaging 1.00
R0602:Col25a1 UTSW 3 130575414 splice site probably null
R0670:Col25a1 UTSW 3 130386895 missense possibly damaging 0.95
R0830:Col25a1 UTSW 3 130584726 missense probably damaging 1.00
R1220:Col25a1 UTSW 3 130388925 splice site probably benign
R1623:Col25a1 UTSW 3 130550050 missense probably damaging 1.00
R1818:Col25a1 UTSW 3 130585737 critical splice donor site probably null
R2142:Col25a1 UTSW 3 130570316 missense probably damaging 1.00
R2190:Col25a1 UTSW 3 130584715 missense probably damaging 1.00
R2901:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R2902:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R3703:Col25a1 UTSW 3 130550033 splice site probably null
R3818:Col25a1 UTSW 3 130550071 missense possibly damaging 0.88
R4726:Col25a1 UTSW 3 130519781 missense possibly damaging 0.92
R4775:Col25a1 UTSW 3 130182819 missense possibly damaging 0.96
R5036:Col25a1 UTSW 3 130583329 splice site probably null
R5110:Col25a1 UTSW 3 130584725 makesense probably null
R5501:Col25a1 UTSW 3 130595663 missense probably benign 0.07
R5686:Col25a1 UTSW 3 130564154 missense probably damaging 1.00
R6131:Col25a1 UTSW 3 130535465 missense probably damaging 1.00
R6142:Col25a1 UTSW 3 130583329 splice site probably benign
R6549:Col25a1 UTSW 3 130182795 missense probably benign
R6624:Col25a1 UTSW 3 130566451 splice site probably null
R6898:Col25a1 UTSW 3 130584728 critical splice donor site probably null
R7030:Col25a1 UTSW 3 130479022 critical splice donor site probably null
R7114:Col25a1 UTSW 3 130595675 missense probably benign 0.06
R7172:Col25a1 UTSW 3 130570332 nonsense probably null
R7179:Col25a1 UTSW 3 130530119 missense probably damaging 0.99
R7340:Col25a1 UTSW 3 130546357 splice site probably null
R7488:Col25a1 UTSW 3 130584701 missense probably damaging 1.00
R7699:Col25a1 UTSW 3 130522479 critical splice donor site probably null
R7976:Col25a1 UTSW 3 130496426 missense probably damaging 1.00
R8129:Col25a1 UTSW 3 130496401 missense probably damaging 1.00
R8199:Col25a1 UTSW 3 130551979 missense probably damaging 1.00
R8524:Col25a1 UTSW 3 130549224 missense probably damaging 1.00
R8809:Col25a1 UTSW 3 130560817 critical splice acceptor site probably null
X0028:Col25a1 UTSW 3 130577318 missense possibly damaging 0.85
Z1176:Col25a1 UTSW 3 130182795 frame shift probably null
Z1177:Col25a1 UTSW 3 130522461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTACAGTCAAGGGCAGGCTATC -3'
(R):5'- GCTAAGATGGAGGTCTTGTGATCC -3'

Sequencing Primer
(F):5'- CAGGCTATCAGCTCTTTGTGAAATG -3'
(R):5'- ATCCTTAGCATGTAGTAAGTAGGGC -3'
Posted On2017-01-03