Incidental Mutation 'R5698:Olfr156'
ID450775
Institutional Source Beutler Lab
Gene Symbol Olfr156
Ensembl Gene ENSMUSG00000110970
Gene Nameolfactory receptor 156
SynonymsGA_x6K02T2N78B-16125144-16126100, OR37B, Olfr37b, mOR37b, MOR262-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43820132-43823895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43821183 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 59 (M59I)
Ref Sequence ENSEMBL: ENSMUSP00000148995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079234] [ENSMUST00000079465] [ENSMUST00000214843] [ENSMUST00000215406]
Predicted Effect probably damaging
Transcript: ENSMUST00000079234
AA Change: M59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078226
Gene: ENSMUSG00000110970
AA Change: M59I

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 4.8e-58 PFAM
Pfam:7tm_1 41 296 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079465
AA Change: M59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: M59I

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214843
AA Change: M59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215406
AA Change: M59I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Olfr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Olfr156 APN 4 43821289 missense possibly damaging 0.83
IGL02690:Olfr156 APN 4 43821190 missense possibly damaging 0.50
R1454:Olfr156 UTSW 4 43820639 missense probably damaging 1.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1859:Olfr156 UTSW 4 43820779 missense possibly damaging 0.91
R2146:Olfr156 UTSW 4 43821178 missense probably damaging 1.00
R3160:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3414:Olfr156 UTSW 4 43821258 missense probably benign 0.00
R3936:Olfr156 UTSW 4 43821359 start codon destroyed probably benign 0.01
R4497:Olfr156 UTSW 4 43821175 missense probably damaging 1.00
R4631:Olfr156 UTSW 4 43820563 missense probably benign 0.08
R5125:Olfr156 UTSW 4 43820480 missense probably benign 0.15
R5371:Olfr156 UTSW 4 43821058 missense probably damaging 1.00
R5807:Olfr156 UTSW 4 43820912 missense probably benign 0.00
R5889:Olfr156 UTSW 4 43820492 missense possibly damaging 0.89
R6461:Olfr156 UTSW 4 43821355 missense probably benign
R6865:Olfr156 UTSW 4 43821346 missense probably benign 0.00
R7566:Olfr156 UTSW 4 43820711 missense probably damaging 1.00
R7908:Olfr156 UTSW 4 43821086 missense probably damaging 1.00
Z1177:Olfr156 UTSW 4 43820900 missense possibly damaging 0.90
Z1177:Olfr156 UTSW 4 43821337 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTTCATGACCACAGGG -3'
(R):5'- AAGGAGCCAATCAGTCTACGG -3'

Sequencing Primer
(F):5'- GTTGCAGATGGCCACATAACGATC -3'
(R):5'- AGCCAATCAGTCTACGGTAGCTG -3'
Posted On2017-01-03