Incidental Mutation 'R5698:Oas1h'
ID 450778
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R5698 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121009045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 252 (A252S)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: A252S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: A252S

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,926,366 (GRCm39) K334E possibly damaging Het
Ache G A 5: 137,288,821 (GRCm39) V176M probably damaging Het
Acss3 T C 10: 106,784,605 (GRCm39) D539G probably damaging Het
Adam6b T A 12: 113,455,083 (GRCm39) D633E probably benign Het
Aldh16a1 G A 7: 44,803,831 (GRCm39) probably benign Het
Amigo2 G A 15: 97,143,607 (GRCm39) Q272* probably null Het
Aoc1l1 A G 6: 48,953,256 (GRCm39) T394A possibly damaging Het
Appbp2 A T 11: 85,100,925 (GRCm39) H171Q probably damaging Het
Arhgef18 A G 8: 3,489,499 (GRCm39) D277G probably damaging Het
Armc8 A G 9: 99,417,873 (GRCm39) V95A probably benign Het
Atp6v0a4 C T 6: 38,027,442 (GRCm39) probably null Het
Atp8a1 A T 5: 67,924,496 (GRCm39) N289K probably benign Het
Cand2 C T 6: 115,768,704 (GRCm39) L505F probably damaging Het
Ccnt2 A G 1: 127,730,965 (GRCm39) K614R probably benign Het
Col25a1 A G 3: 130,272,632 (GRCm39) probably null Het
Copa T A 1: 171,946,511 (GRCm39) L976* probably null Het
Ddx39b T C 17: 35,470,287 (GRCm39) V267A probably benign Het
Dpp4 T A 2: 62,164,655 (GRCm39) Q709L probably damaging Het
Eno4 A G 19: 58,956,904 (GRCm39) probably null Het
Exoc3 A G 13: 74,322,134 (GRCm39) L647P probably benign Het
Eya4 T C 10: 23,015,975 (GRCm39) S308G possibly damaging Het
Fbxo41 T C 6: 85,454,638 (GRCm39) T693A possibly damaging Het
Fcgbp A G 7: 27,791,447 (GRCm39) T903A possibly damaging Het
Fkbp10 G T 11: 100,314,352 (GRCm39) W384L probably damaging Het
Frem2 A G 3: 53,559,926 (GRCm39) I1527T possibly damaging Het
H13 T A 2: 152,530,875 (GRCm39) I220N probably damaging Het
Has2 T C 15: 56,531,312 (GRCm39) R468G probably damaging Het
Ighmbp2 A G 19: 3,324,538 (GRCm39) S243P probably damaging Het
Irs1 T C 1: 82,266,455 (GRCm39) H587R probably benign Het
Kcnk1 C T 8: 126,752,144 (GRCm39) T250M probably damaging Het
Kif9 T C 9: 110,339,532 (GRCm39) V458A probably benign Het
Krt14 T C 11: 100,096,451 (GRCm39) T208A probably benign Het
Mybpc3 C A 2: 90,955,194 (GRCm39) H349Q possibly damaging Het
Neurl3 T A 1: 36,305,587 (GRCm39) T207S possibly damaging Het
Nol9 T C 4: 152,135,031 (GRCm39) V388A probably damaging Het
Notch3 T C 17: 32,376,961 (GRCm39) N315D probably damaging Het
Or13c7b C A 4: 43,821,183 (GRCm39) M59I probably damaging Het
Pcbp1 G A 6: 86,502,134 (GRCm39) T255M possibly damaging Het
Plec A G 15: 76,083,808 (GRCm39) V18A probably benign Het
Ppp1r17 A T 6: 56,003,529 (GRCm39) E114V probably damaging Het
Scamp5 A T 9: 57,352,716 (GRCm39) M151K possibly damaging Het
Sestd1 T C 2: 77,048,512 (GRCm39) Y135C possibly damaging Het
Slc22a21 T G 11: 53,842,175 (GRCm39) K534N probably benign Het
Slc25a12 T C 2: 71,112,917 (GRCm39) E448G probably damaging Het
Slco3a1 A G 7: 73,996,566 (GRCm39) L280P probably damaging Het
Sppl2b C A 10: 80,701,879 (GRCm39) probably null Het
Srd5a2 T C 17: 74,334,014 (GRCm39) E135G possibly damaging Het
Tfg A T 16: 56,521,467 (GRCm39) M183K probably damaging Het
Ticrr G A 7: 79,328,881 (GRCm39) M673I probably benign Het
Tm4sf20 T G 1: 82,745,958 (GRCm39) M61L probably benign Het
Ttll8 A T 15: 88,823,209 (GRCm39) S85T possibly damaging Het
Uggt2 G A 14: 119,280,138 (GRCm39) S780F probably damaging Het
Uroc1 T C 6: 90,324,302 (GRCm39) L442P probably damaging Het
Zfp1005 C T 2: 150,111,394 (GRCm39) H695Y possibly damaging Het
Znrf3 A G 11: 5,239,006 (GRCm39) probably benign Het
Zswim2 C A 2: 83,755,527 (GRCm39) D125Y possibly damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTTGGCTATAGCAGAGG -3'
(R):5'- GGAGACAAGCTACCTGACTC -3'

Sequencing Primer
(F):5'- GACTGAGTCTAAATAACTGGCTGTG -3'
(R):5'- GGAGACAAGCTACCTGACTCTTTTG -3'
Posted On 2017-01-03