Incidental Mutation 'R0550:Sh3tc1'
ID 45078
Institutional Source Beutler Lab
Gene Symbol Sh3tc1
Ensembl Gene ENSMUSG00000036553
Gene Name SH3 domain and tetratricopeptide repeats 1
Synonyms
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 35854524-35897331 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35857128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1237 (E1237G)
Ref Sequence ENSEMBL: ENSMUSP00000144175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]
AlphaFold G3X9F6
Predicted Effect probably damaging
Transcript: ENSMUST00000070203
AA Change: E1237G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: E1237G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127288
Predicted Effect unknown
Transcript: ENSMUST00000127825
AA Change: N1138D
SMART Domains Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: N1138D

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
SH3 251 310 1.72e-6 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
TPR 504 537 3.41e1 SMART
Blast:TPR 546 578 2e-6 BLAST
TPR 607 640 3.37e-2 SMART
TPR 735 768 6.4e1 SMART
Blast:TPR 813 841 2e-6 BLAST
TPR 852 885 9.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129664
SMART Domains Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
SH3 76 130 2.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151555
Predicted Effect probably damaging
Transcript: ENSMUST00000201511
AA Change: E1237G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: E1237G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.2043 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Sh3tc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Sh3tc1 APN 5 35,868,301 (GRCm39) missense probably damaging 1.00
IGL01019:Sh3tc1 APN 5 35,860,719 (GRCm39) missense probably damaging 1.00
IGL01725:Sh3tc1 APN 5 35,857,660 (GRCm39) missense probably benign 0.08
IGL02069:Sh3tc1 APN 5 35,876,339 (GRCm39) missense probably benign 0.45
IGL02153:Sh3tc1 APN 5 35,860,696 (GRCm39) missense probably damaging 1.00
IGL02269:Sh3tc1 APN 5 35,863,628 (GRCm39) missense probably benign 0.21
IGL02609:Sh3tc1 APN 5 35,864,516 (GRCm39) missense probably damaging 0.99
IGL02984:Sh3tc1 UTSW 5 35,871,403 (GRCm39) splice site probably null
R0280:Sh3tc1 UTSW 5 35,863,361 (GRCm39) missense probably damaging 1.00
R0305:Sh3tc1 UTSW 5 35,881,343 (GRCm39) missense probably benign
R0322:Sh3tc1 UTSW 5 35,863,905 (GRCm39) missense possibly damaging 0.86
R0485:Sh3tc1 UTSW 5 35,859,356 (GRCm39) splice site probably benign
R0511:Sh3tc1 UTSW 5 35,860,806 (GRCm39) missense probably damaging 1.00
R0513:Sh3tc1 UTSW 5 35,857,651 (GRCm39) missense possibly damaging 0.87
R0523:Sh3tc1 UTSW 5 35,881,410 (GRCm39) small deletion probably benign
R0676:Sh3tc1 UTSW 5 35,876,458 (GRCm39) splice site probably benign
R1485:Sh3tc1 UTSW 5 35,876,370 (GRCm39) missense probably benign 0.00
R1559:Sh3tc1 UTSW 5 35,860,693 (GRCm39) critical splice donor site probably null
R1599:Sh3tc1 UTSW 5 35,864,856 (GRCm39) missense probably benign 0.05
R1759:Sh3tc1 UTSW 5 35,863,248 (GRCm39) missense possibly damaging 0.95
R1808:Sh3tc1 UTSW 5 35,863,268 (GRCm39) missense probably benign 0.01
R1816:Sh3tc1 UTSW 5 35,857,928 (GRCm39) critical splice donor site probably null
R2036:Sh3tc1 UTSW 5 35,873,508 (GRCm39) missense probably benign 0.01
R2092:Sh3tc1 UTSW 5 35,858,002 (GRCm39) missense probably damaging 1.00
R2944:Sh3tc1 UTSW 5 35,871,504 (GRCm39) missense probably damaging 1.00
R4258:Sh3tc1 UTSW 5 35,864,322 (GRCm39) missense probably benign 0.00
R4556:Sh3tc1 UTSW 5 35,864,426 (GRCm39) missense probably damaging 1.00
R4647:Sh3tc1 UTSW 5 35,863,662 (GRCm39) missense probably damaging 1.00
R5011:Sh3tc1 UTSW 5 35,857,633 (GRCm39) missense probably damaging 1.00
R5740:Sh3tc1 UTSW 5 35,864,399 (GRCm39) missense probably benign 0.00
R6023:Sh3tc1 UTSW 5 35,864,295 (GRCm39) nonsense probably null
R6164:Sh3tc1 UTSW 5 35,863,590 (GRCm39) missense probably benign 0.05
R6262:Sh3tc1 UTSW 5 35,857,117 (GRCm39) missense probably damaging 1.00
R6433:Sh3tc1 UTSW 5 35,863,941 (GRCm39) missense probably damaging 0.99
R6932:Sh3tc1 UTSW 5 35,864,778 (GRCm39) missense probably benign 0.01
R6986:Sh3tc1 UTSW 5 35,881,288 (GRCm39) missense probably benign
R7098:Sh3tc1 UTSW 5 35,859,358 (GRCm39) splice site probably null
R7502:Sh3tc1 UTSW 5 35,863,406 (GRCm39) missense probably damaging 0.96
R7737:Sh3tc1 UTSW 5 35,881,297 (GRCm39) missense probably benign 0.15
R7792:Sh3tc1 UTSW 5 35,868,295 (GRCm39) missense probably damaging 0.97
R8079:Sh3tc1 UTSW 5 35,864,201 (GRCm39) missense possibly damaging 0.78
R8154:Sh3tc1 UTSW 5 35,875,696 (GRCm39) missense probably damaging 1.00
R8267:Sh3tc1 UTSW 5 35,863,751 (GRCm39) missense probably benign 0.01
R8300:Sh3tc1 UTSW 5 35,854,792 (GRCm39) missense probably benign 0.00
R8416:Sh3tc1 UTSW 5 35,868,256 (GRCm39) missense probably damaging 0.99
R8459:Sh3tc1 UTSW 5 35,878,933 (GRCm39) missense probably benign
R8699:Sh3tc1 UTSW 5 35,859,235 (GRCm39) missense probably damaging 1.00
R8754:Sh3tc1 UTSW 5 35,863,802 (GRCm39) missense probably benign 0.07
R8782:Sh3tc1 UTSW 5 35,871,548 (GRCm39) missense possibly damaging 0.93
R9044:Sh3tc1 UTSW 5 35,854,834 (GRCm39) missense possibly damaging 0.84
R9047:Sh3tc1 UTSW 5 35,863,827 (GRCm39) missense probably benign
R9092:Sh3tc1 UTSW 5 35,874,321 (GRCm39) missense probably benign 0.00
R9771:Sh3tc1 UTSW 5 35,873,654 (GRCm39) missense probably damaging 1.00
X0061:Sh3tc1 UTSW 5 35,864,153 (GRCm39) missense probably damaging 1.00
Z1176:Sh3tc1 UTSW 5 35,871,573 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCACACTCAGGTGGAACAATGACTC -3'
(R):5'- TTCTCTTGCTGGGACCACATGC -3'

Sequencing Primer
(F):5'- GGTGGAACAATGACTCTACCC -3'
(R):5'- GCCTTACTGGGTAGTGTCCTC -3'
Posted On 2013-06-11