Incidental Mutation 'R0550:Sh3tc1'
ID 45078
Institutional Source Beutler Lab
Gene Symbol Sh3tc1
Ensembl Gene ENSMUSG00000036553
Gene Name SH3 domain and tetratricopeptide repeats 1
Synonyms
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 35697180-35739987 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35699784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1237 (E1237G)
Ref Sequence ENSEMBL: ENSMUSP00000144175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]
AlphaFold G3X9F6
Predicted Effect probably damaging
Transcript: ENSMUST00000070203
AA Change: E1237G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: E1237G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127288
Predicted Effect unknown
Transcript: ENSMUST00000127825
AA Change: N1138D
SMART Domains Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: N1138D

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
SH3 251 310 1.72e-6 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
TPR 504 537 3.41e1 SMART
Blast:TPR 546 578 2e-6 BLAST
TPR 607 640 3.37e-2 SMART
TPR 735 768 6.4e1 SMART
Blast:TPR 813 841 2e-6 BLAST
TPR 852 885 9.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129664
SMART Domains Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
SH3 76 130 2.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151555
Predicted Effect probably damaging
Transcript: ENSMUST00000201511
AA Change: E1237G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: E1237G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.2043 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Sh3tc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Sh3tc1 APN 5 35710957 missense probably damaging 1.00
IGL01019:Sh3tc1 APN 5 35703375 missense probably damaging 1.00
IGL01725:Sh3tc1 APN 5 35700316 missense probably benign 0.08
IGL02069:Sh3tc1 APN 5 35718995 missense probably benign 0.45
IGL02153:Sh3tc1 APN 5 35703352 missense probably damaging 1.00
IGL02269:Sh3tc1 APN 5 35706284 missense probably benign 0.21
IGL02609:Sh3tc1 APN 5 35707172 missense probably damaging 0.99
IGL02984:Sh3tc1 UTSW 5 35714059 splice site probably null
R0280:Sh3tc1 UTSW 5 35706017 missense probably damaging 1.00
R0305:Sh3tc1 UTSW 5 35723999 missense probably benign
R0322:Sh3tc1 UTSW 5 35706561 missense possibly damaging 0.86
R0485:Sh3tc1 UTSW 5 35702012 splice site probably benign
R0511:Sh3tc1 UTSW 5 35703462 missense probably damaging 1.00
R0513:Sh3tc1 UTSW 5 35700307 missense possibly damaging 0.87
R0523:Sh3tc1 UTSW 5 35724066 small deletion probably benign
R0676:Sh3tc1 UTSW 5 35719114 splice site probably benign
R1485:Sh3tc1 UTSW 5 35719026 missense probably benign 0.00
R1559:Sh3tc1 UTSW 5 35703349 critical splice donor site probably null
R1599:Sh3tc1 UTSW 5 35707512 missense probably benign 0.05
R1759:Sh3tc1 UTSW 5 35705904 missense possibly damaging 0.95
R1808:Sh3tc1 UTSW 5 35705924 missense probably benign 0.01
R1816:Sh3tc1 UTSW 5 35700584 critical splice donor site probably null
R2036:Sh3tc1 UTSW 5 35716164 missense probably benign 0.01
R2092:Sh3tc1 UTSW 5 35700658 missense probably damaging 1.00
R2944:Sh3tc1 UTSW 5 35714160 missense probably damaging 1.00
R4258:Sh3tc1 UTSW 5 35706978 missense probably benign 0.00
R4556:Sh3tc1 UTSW 5 35707082 missense probably damaging 1.00
R4647:Sh3tc1 UTSW 5 35706318 missense probably damaging 1.00
R5011:Sh3tc1 UTSW 5 35700289 missense probably damaging 1.00
R5740:Sh3tc1 UTSW 5 35707055 missense probably benign 0.00
R6023:Sh3tc1 UTSW 5 35706951 nonsense probably null
R6164:Sh3tc1 UTSW 5 35706246 missense probably benign 0.05
R6262:Sh3tc1 UTSW 5 35699773 missense probably damaging 1.00
R6433:Sh3tc1 UTSW 5 35706597 missense probably damaging 0.99
R6932:Sh3tc1 UTSW 5 35707434 missense probably benign 0.01
R6986:Sh3tc1 UTSW 5 35723944 missense probably benign
R7098:Sh3tc1 UTSW 5 35702014 splice site probably null
R7502:Sh3tc1 UTSW 5 35706062 missense probably damaging 0.96
R7737:Sh3tc1 UTSW 5 35723953 missense probably benign 0.15
R7792:Sh3tc1 UTSW 5 35710951 missense probably damaging 0.97
R8079:Sh3tc1 UTSW 5 35706857 missense possibly damaging 0.78
R8154:Sh3tc1 UTSW 5 35718352 missense probably damaging 1.00
R8267:Sh3tc1 UTSW 5 35706407 missense probably benign 0.01
R8300:Sh3tc1 UTSW 5 35697448 missense probably benign 0.00
R8416:Sh3tc1 UTSW 5 35710912 missense probably damaging 0.99
R8459:Sh3tc1 UTSW 5 35721589 missense probably benign
R8699:Sh3tc1 UTSW 5 35701891 missense probably damaging 1.00
R8754:Sh3tc1 UTSW 5 35706458 missense probably benign 0.07
R8782:Sh3tc1 UTSW 5 35714204 missense possibly damaging 0.93
R9044:Sh3tc1 UTSW 5 35697490 missense possibly damaging 0.84
R9047:Sh3tc1 UTSW 5 35706483 missense probably benign
R9092:Sh3tc1 UTSW 5 35716977 missense probably benign 0.00
R9771:Sh3tc1 UTSW 5 35716310 missense probably damaging 1.00
X0061:Sh3tc1 UTSW 5 35706809 missense probably damaging 1.00
Z1176:Sh3tc1 UTSW 5 35714229 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCACACTCAGGTGGAACAATGACTC -3'
(R):5'- TTCTCTTGCTGGGACCACATGC -3'

Sequencing Primer
(F):5'- GGTGGAACAATGACTCTACCC -3'
(R):5'- GCCTTACTGGGTAGTGTCCTC -3'
Posted On 2013-06-11