Incidental Mutation 'R5698:Pcbp1'
ID450785
Institutional Source Beutler Lab
Gene Symbol Pcbp1
Ensembl Gene ENSMUSG00000051695
Gene Namepoly(rC) binding protein 1
SynonymshnRNP E1, WBP17, [a]CP-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86524492-86526321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86525152 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 255 (T255M)
Ref Sequence ENSEMBL: ENSMUSP00000054863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053015]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053015
AA Change: T255M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054863
Gene: ENSMUSG00000051695
AA Change: T255M

DomainStartEndE-ValueType
KH 12 80 3.99e-16 SMART
KH 96 167 2.39e-14 SMART
KH 278 348 1.34e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced body weight. Mice homozygous for the allele exhibit embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Pcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Pcbp1 APN 6 86525854 missense probably damaging 0.96
R2968:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R3148:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R4522:Pcbp1 UTSW 6 86525050 missense probably benign 0.01
R5119:Pcbp1 UTSW 6 86524915 missense probably damaging 1.00
R5225:Pcbp1 UTSW 6 86525227 missense probably damaging 0.96
R5386:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R7135:Pcbp1 UTSW 6 86525506 missense possibly damaging 0.80
R7329:Pcbp1 UTSW 6 86525116 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATTTTGATCTGGGCCCCGG -3'
(R):5'- TCATGACCATCCCGTACCAG -3'

Sequencing Primer
(F):5'- GACATCTGGCGGATCTCATTG -3'
(R):5'- AGCTCGCCAGTCATCTGC -3'
Posted On2017-01-03