Incidental Mutation 'R5698:Cand2'
ID450787
Institutional Source Beutler Lab
Gene Symbol Cand2
Ensembl Gene ENSMUSG00000030319
Gene Namecullin-associated and neddylation-dissociated 2 (putative)
Synonyms2210404G23Rik, Tp120b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115774538-115805557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115791743 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 505 (L505F)
Ref Sequence ENSEMBL: ENSMUSP00000075377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075995]
Predicted Effect probably damaging
Transcript: ENSMUST00000075995
AA Change: L505F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: L505F

DomainStartEndE-ValueType
low complexity region 325 347 N/A INTRINSIC
low complexity region 536 548 N/A INTRINSIC
low complexity region 553 562 N/A INTRINSIC
low complexity region 665 686 N/A INTRINSIC
low complexity region 736 748 N/A INTRINSIC
Pfam:HEAT 861 890 4.4e-5 PFAM
Pfam:TIP120 1044 1209 6e-64 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Cand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Cand2 APN 6 115785125 missense probably benign
IGL01329:Cand2 APN 6 115782794 missense probably benign 0.43
IGL01777:Cand2 APN 6 115792857 missense probably damaging 0.99
IGL02008:Cand2 APN 6 115803638 missense probably damaging 1.00
IGL02185:Cand2 APN 6 115789510 missense probably benign 0.01
IGL02219:Cand2 APN 6 115803812 missense probably damaging 1.00
IGL02240:Cand2 APN 6 115803662 missense probably damaging 1.00
IGL02329:Cand2 APN 6 115789607 missense probably damaging 1.00
IGL02396:Cand2 APN 6 115791188 splice site probably benign
IGL02893:Cand2 APN 6 115791960 missense probably damaging 1.00
IGL03161:Cand2 APN 6 115792737 missense probably benign 0.45
IGL03170:Cand2 APN 6 115797900 missense probably damaging 1.00
IGL03257:Cand2 APN 6 115799983 missense possibly damaging 0.80
succor UTSW 6 115791192 missense probably damaging 1.00
R0196:Cand2 UTSW 6 115789502 missense probably damaging 1.00
R0390:Cand2 UTSW 6 115774653 missense possibly damaging 0.90
R0534:Cand2 UTSW 6 115787236 missense probably damaging 0.96
R0630:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0631:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0662:Cand2 UTSW 6 115787210 missense probably benign 0.00
R0671:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0708:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0849:Cand2 UTSW 6 115792391 missense probably damaging 1.00
R1992:Cand2 UTSW 6 115785132 missense possibly damaging 0.88
R3428:Cand2 UTSW 6 115789707 missense probably benign
R3773:Cand2 UTSW 6 115785217 missense probably damaging 0.96
R4329:Cand2 UTSW 6 115799988 missense possibly damaging 0.64
R4489:Cand2 UTSW 6 115789466 missense probably damaging 1.00
R4553:Cand2 UTSW 6 115792211 missense probably damaging 1.00
R4577:Cand2 UTSW 6 115791259 missense probably damaging 1.00
R4634:Cand2 UTSW 6 115797987 missense probably damaging 1.00
R4850:Cand2 UTSW 6 115801948 missense probably benign 0.14
R5155:Cand2 UTSW 6 115792258 missense probably benign 0.42
R5190:Cand2 UTSW 6 115789513 missense probably damaging 1.00
R5378:Cand2 UTSW 6 115801951 missense probably benign 0.00
R5407:Cand2 UTSW 6 115785200 missense possibly damaging 0.76
R5701:Cand2 UTSW 6 115797932 missense probably damaging 0.99
R6172:Cand2 UTSW 6 115791310 missense probably benign 0.00
R6763:Cand2 UTSW 6 115799969 missense probably benign 0.00
R6920:Cand2 UTSW 6 115791289 missense possibly damaging 0.93
R7229:Cand2 UTSW 6 115791192 missense probably damaging 1.00
R7520:Cand2 UTSW 6 115785251 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTAAGATGAGTTCTGGCCTTG -3'
(R):5'- ACATATGGTTCAGGGTCCAGC -3'

Sequencing Primer
(F):5'- CTCAGCTCTGGTGGCTTCTAG -3'
(R):5'- AGCAGCCGAGGCCTATC -3'
Posted On2017-01-03