Incidental Mutation 'R5698:Eya4'
ID 450797
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene Name EYA transcriptional coactivator and phosphatase 4
Synonyms B130023L16Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5698 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 22978862-23226684 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23015975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 308 (S308G)
Ref Sequence ENSEMBL: ENSMUSP00000151287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
AlphaFold Q9Z191
Predicted Effect possibly damaging
Transcript: ENSMUST00000074366
AA Change: S308G

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: S308G

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000092665
AA Change: S308G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: S308G

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000219315
AA Change: S331G

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220299
AA Change: S308G

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,926,366 (GRCm39) K334E possibly damaging Het
Ache G A 5: 137,288,821 (GRCm39) V176M probably damaging Het
Acss3 T C 10: 106,784,605 (GRCm39) D539G probably damaging Het
Adam6b T A 12: 113,455,083 (GRCm39) D633E probably benign Het
Aldh16a1 G A 7: 44,803,831 (GRCm39) probably benign Het
Amigo2 G A 15: 97,143,607 (GRCm39) Q272* probably null Het
Aoc1l1 A G 6: 48,953,256 (GRCm39) T394A possibly damaging Het
Appbp2 A T 11: 85,100,925 (GRCm39) H171Q probably damaging Het
Arhgef18 A G 8: 3,489,499 (GRCm39) D277G probably damaging Het
Armc8 A G 9: 99,417,873 (GRCm39) V95A probably benign Het
Atp6v0a4 C T 6: 38,027,442 (GRCm39) probably null Het
Atp8a1 A T 5: 67,924,496 (GRCm39) N289K probably benign Het
Cand2 C T 6: 115,768,704 (GRCm39) L505F probably damaging Het
Ccnt2 A G 1: 127,730,965 (GRCm39) K614R probably benign Het
Col25a1 A G 3: 130,272,632 (GRCm39) probably null Het
Copa T A 1: 171,946,511 (GRCm39) L976* probably null Het
Ddx39b T C 17: 35,470,287 (GRCm39) V267A probably benign Het
Dpp4 T A 2: 62,164,655 (GRCm39) Q709L probably damaging Het
Eno4 A G 19: 58,956,904 (GRCm39) probably null Het
Exoc3 A G 13: 74,322,134 (GRCm39) L647P probably benign Het
Fbxo41 T C 6: 85,454,638 (GRCm39) T693A possibly damaging Het
Fcgbp A G 7: 27,791,447 (GRCm39) T903A possibly damaging Het
Fkbp10 G T 11: 100,314,352 (GRCm39) W384L probably damaging Het
Frem2 A G 3: 53,559,926 (GRCm39) I1527T possibly damaging Het
H13 T A 2: 152,530,875 (GRCm39) I220N probably damaging Het
Has2 T C 15: 56,531,312 (GRCm39) R468G probably damaging Het
Ighmbp2 A G 19: 3,324,538 (GRCm39) S243P probably damaging Het
Irs1 T C 1: 82,266,455 (GRCm39) H587R probably benign Het
Kcnk1 C T 8: 126,752,144 (GRCm39) T250M probably damaging Het
Kif9 T C 9: 110,339,532 (GRCm39) V458A probably benign Het
Krt14 T C 11: 100,096,451 (GRCm39) T208A probably benign Het
Mybpc3 C A 2: 90,955,194 (GRCm39) H349Q possibly damaging Het
Neurl3 T A 1: 36,305,587 (GRCm39) T207S possibly damaging Het
Nol9 T C 4: 152,135,031 (GRCm39) V388A probably damaging Het
Notch3 T C 17: 32,376,961 (GRCm39) N315D probably damaging Het
Oas1h G T 5: 121,009,045 (GRCm39) A252S probably damaging Het
Or13c7b C A 4: 43,821,183 (GRCm39) M59I probably damaging Het
Pcbp1 G A 6: 86,502,134 (GRCm39) T255M possibly damaging Het
Plec A G 15: 76,083,808 (GRCm39) V18A probably benign Het
Ppp1r17 A T 6: 56,003,529 (GRCm39) E114V probably damaging Het
Scamp5 A T 9: 57,352,716 (GRCm39) M151K possibly damaging Het
Sestd1 T C 2: 77,048,512 (GRCm39) Y135C possibly damaging Het
Slc22a21 T G 11: 53,842,175 (GRCm39) K534N probably benign Het
Slc25a12 T C 2: 71,112,917 (GRCm39) E448G probably damaging Het
Slco3a1 A G 7: 73,996,566 (GRCm39) L280P probably damaging Het
Sppl2b C A 10: 80,701,879 (GRCm39) probably null Het
Srd5a2 T C 17: 74,334,014 (GRCm39) E135G possibly damaging Het
Tfg A T 16: 56,521,467 (GRCm39) M183K probably damaging Het
Ticrr G A 7: 79,328,881 (GRCm39) M673I probably benign Het
Tm4sf20 T G 1: 82,745,958 (GRCm39) M61L probably benign Het
Ttll8 A T 15: 88,823,209 (GRCm39) S85T possibly damaging Het
Uggt2 G A 14: 119,280,138 (GRCm39) S780F probably damaging Het
Uroc1 T C 6: 90,324,302 (GRCm39) L442P probably damaging Het
Zfp1005 C T 2: 150,111,394 (GRCm39) H695Y possibly damaging Het
Znrf3 A G 11: 5,239,006 (GRCm39) probably benign Het
Zswim2 C A 2: 83,755,527 (GRCm39) D125Y possibly damaging Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23,034,995 (GRCm39) missense probably benign 0.17
IGL00507:Eya4 APN 10 23,033,434 (GRCm39) nonsense probably null
IGL01324:Eya4 APN 10 22,992,449 (GRCm39) critical splice donor site probably null
IGL01350:Eya4 APN 10 22,989,873 (GRCm39) missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23,015,897 (GRCm39) missense probably benign 0.01
IGL02682:Eya4 APN 10 22,992,498 (GRCm39) missense probably damaging 1.00
IGL02688:Eya4 APN 10 23,035,008 (GRCm39) missense probably benign 0.01
IGL03071:Eya4 APN 10 23,198,971 (GRCm39) missense probably benign 0.07
R0420:Eya4 UTSW 10 23,031,861 (GRCm39) missense possibly damaging 0.85
R1688:Eya4 UTSW 10 22,999,759 (GRCm39) missense probably damaging 1.00
R2312:Eya4 UTSW 10 22,982,163 (GRCm39) missense probably damaging 1.00
R3029:Eya4 UTSW 10 22,999,776 (GRCm39) missense probably benign
R3853:Eya4 UTSW 10 22,992,574 (GRCm39) missense probably damaging 1.00
R3872:Eya4 UTSW 10 23,031,870 (GRCm39) missense probably damaging 0.97
R4113:Eya4 UTSW 10 23,031,849 (GRCm39) missense probably damaging 0.98
R4210:Eya4 UTSW 10 23,102,698 (GRCm39) critical splice donor site probably null
R4457:Eya4 UTSW 10 22,992,566 (GRCm39) missense probably damaging 1.00
R4691:Eya4 UTSW 10 23,015,966 (GRCm39) missense probably benign 0.03
R4894:Eya4 UTSW 10 22,985,753 (GRCm39) missense possibly damaging 0.55
R5345:Eya4 UTSW 10 22,985,947 (GRCm39) missense probably benign 0.00
R5473:Eya4 UTSW 10 23,039,351 (GRCm39) missense probably benign 0.02
R5547:Eya4 UTSW 10 22,985,753 (GRCm39) missense possibly damaging 0.55
R5951:Eya4 UTSW 10 23,031,892 (GRCm39) missense probably damaging 1.00
R5953:Eya4 UTSW 10 23,027,871 (GRCm39) missense probably damaging 1.00
R6111:Eya4 UTSW 10 23,015,953 (GRCm39) missense possibly damaging 0.67
R6413:Eya4 UTSW 10 22,992,724 (GRCm39) missense probably damaging 1.00
R6460:Eya4 UTSW 10 23,027,910 (GRCm39) missense probably benign 0.05
R7144:Eya4 UTSW 10 23,048,943 (GRCm39) missense probably benign 0.00
R7169:Eya4 UTSW 10 23,031,845 (GRCm39) missense probably benign 0.42
R7358:Eya4 UTSW 10 22,999,749 (GRCm39) critical splice donor site probably null
R7549:Eya4 UTSW 10 22,987,557 (GRCm39) missense probably damaging 1.00
R7791:Eya4 UTSW 10 22,989,825 (GRCm39) missense probably damaging 1.00
R7793:Eya4 UTSW 10 23,102,714 (GRCm39) missense probably benign
R8550:Eya4 UTSW 10 22,982,157 (GRCm39) missense probably damaging 1.00
R8553:Eya4 UTSW 10 22,982,157 (GRCm39) missense probably damaging 1.00
R8556:Eya4 UTSW 10 22,982,157 (GRCm39) missense probably damaging 1.00
R8703:Eya4 UTSW 10 23,039,340 (GRCm39) missense probably benign 0.00
R9332:Eya4 UTSW 10 22,989,845 (GRCm39) missense probably damaging 0.97
R9361:Eya4 UTSW 10 22,985,766 (GRCm39) missense probably damaging 1.00
R9408:Eya4 UTSW 10 22,999,805 (GRCm39) missense
R9497:Eya4 UTSW 10 22,987,458 (GRCm39) critical splice donor site probably null
R9713:Eya4 UTSW 10 23,027,870 (GRCm39) nonsense probably null
Z1088:Eya4 UTSW 10 22,989,887 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTTACATTTCACAGAGCTCAC -3'
(R):5'- TGGGTTCTATGAGGAAGTCAATGAATG -3'

Sequencing Primer
(F):5'- TTTCACAGAGCTCACAAATGAAAAAG -3'
(R):5'- TGTCACAAAGAGGTCATTAA -3'
Posted On 2017-01-03