Incidental Mutation 'R5698:Acss3'
ID450802
Institutional Source Beutler Lab
Gene Symbol Acss3
Ensembl Gene ENSMUSG00000035948
Gene Nameacyl-CoA synthetase short-chain family member 3
SynonymsLOC380660, 8430416H19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location106933517-107123668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106948744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 539 (D539G)
Ref Sequence ENSEMBL: ENSMUSP00000128209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165067]
Predicted Effect probably damaging
Transcript: ENSMUST00000165067
AA Change: D539G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128209
Gene: ENSMUSG00000035948
AA Change: D539G

DomainStartEndE-ValueType
Pfam:ACAS_N 57 111 8.8e-22 PFAM
Pfam:AMP-binding 113 557 3.2e-81 PFAM
Pfam:AMP-binding_C 565 644 2.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217746
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Acss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Acss3 APN 10 106966026 missense probably benign
IGL00941:Acss3 APN 10 107053326 critical splice donor site probably null
IGL00983:Acss3 APN 10 106966964 nonsense probably null
IGL01010:Acss3 APN 10 107023849 splice site probably benign
IGL02227:Acss3 APN 10 107045335 missense probably benign
IGL02296:Acss3 APN 10 107053451 nonsense probably null
IGL02319:Acss3 APN 10 106948750 missense probably damaging 0.99
IGL03181:Acss3 APN 10 107053388 missense probably damaging 1.00
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0279:Acss3 UTSW 10 107084871 missense possibly damaging 0.95
R0418:Acss3 UTSW 10 107023912 missense probably damaging 0.99
R0550:Acss3 UTSW 10 107053471 missense probably damaging 1.00
R1114:Acss3 UTSW 10 106988879 missense possibly damaging 0.89
R1491:Acss3 UTSW 10 106937308 missense probably benign
R1625:Acss3 UTSW 10 106937402 critical splice donor site probably null
R1771:Acss3 UTSW 10 106937200 missense probably damaging 1.00
R1956:Acss3 UTSW 10 106936168 missense probably benign 0.00
R2006:Acss3 UTSW 10 106963010 missense possibly damaging 0.81
R2018:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2019:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2078:Acss3 UTSW 10 106967041 missense possibly damaging 0.94
R2253:Acss3 UTSW 10 107004748 missense probably damaging 1.00
R2391:Acss3 UTSW 10 107123487 missense probably benign 0.00
R3082:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R3083:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R4072:Acss3 UTSW 10 107123585 unclassified probably benign
R4086:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4087:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4089:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4090:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4406:Acss3 UTSW 10 107053337 missense probably damaging 1.00
R4607:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4608:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4790:Acss3 UTSW 10 107023702 nonsense probably null
R4834:Acss3 UTSW 10 107084805 critical splice donor site probably null
R5130:Acss3 UTSW 10 107004725 missense possibly damaging 0.87
R5303:Acss3 UTSW 10 107084851 missense possibly damaging 0.74
R5365:Acss3 UTSW 10 107004728 missense probably damaging 1.00
R5439:Acss3 UTSW 10 106937147 nonsense probably null
R5617:Acss3 UTSW 10 106951990 missense probably damaging 1.00
R5726:Acss3 UTSW 10 107123322 missense possibly damaging 0.63
R6154:Acss3 UTSW 10 107123349 missense probably benign 0.02
R6298:Acss3 UTSW 10 107084856 missense probably damaging 1.00
R6592:Acss3 UTSW 10 107023718 missense possibly damaging 0.94
R6707:Acss3 UTSW 10 107084922 missense probably damaging 1.00
R6999:Acss3 UTSW 10 107053501 missense probably damaging 1.00
R7567:Acss3 UTSW 10 107123313 missense probably benign 0.00
R8351:Acss3 UTSW 10 107049404 missense probably damaging 0.98
R8451:Acss3 UTSW 10 107049404 missense probably damaging 0.98
R8515:Acss3 UTSW 10 106948663 missense possibly damaging 0.51
R8917:Acss3 UTSW 10 106937263 missense probably benign
X0027:Acss3 UTSW 10 107123344 missense probably benign 0.05
Z1177:Acss3 UTSW 10 107004777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGATCAGTATACAAGTGAC -3'
(R):5'- AGTTCAGATACCGAACTTGAACAC -3'

Sequencing Primer
(F):5'- TGATCAGTATACAAGTGACACTCAG -3'
(R):5'- GCAACTTAATCTCAAAGTCCAGC -3'
Posted On2017-01-03