Incidental Mutation 'R5698:Slc22a21'
ID450805
Institutional Source Beutler Lab
Gene Symbol Slc22a21
Ensembl Gene ENSMUSG00000063652
Gene Namesolute carrier family 22 (organic cation transporter), member 21
SynonymsOctn3, Slc22a9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53949965-53980332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 53951349 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 534 (K534N)
Ref Sequence ENSEMBL: ENSMUSP00000075814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076493]
Predicted Effect probably benign
Transcript: ENSMUST00000076493
AA Change: K534N

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075814
Gene: ENSMUSG00000063652
AA Change: K534N

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 74 527 3.1e-31 PFAM
Pfam:MFS_1 139 376 3e-13 PFAM
low complexity region 528 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Slc22a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Slc22a21 APN 11 53979581 missense probably damaging 1.00
R0025:Slc22a21 UTSW 11 53979688 missense probably damaging 1.00
R0104:Slc22a21 UTSW 11 53951809 missense probably null 0.88
R0285:Slc22a21 UTSW 11 53959196 splice site probably benign
R0562:Slc22a21 UTSW 11 53979620 nonsense probably null
R0569:Slc22a21 UTSW 11 53951810 missense probably benign 0.00
R1237:Slc22a21 UTSW 11 53979772 missense probably benign 0.36
R2131:Slc22a21 UTSW 11 53979733 missense probably damaging 1.00
R2327:Slc22a21 UTSW 11 53951304 missense probably benign 0.25
R2991:Slc22a21 UTSW 11 53959369 missense probably damaging 1.00
R4209:Slc22a21 UTSW 11 53956055 missense probably benign 0.00
R4290:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4291:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4292:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4294:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4295:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4470:Slc22a21 UTSW 11 53956013 missense probably benign 0.00
R5194:Slc22a21 UTSW 11 53979847 missense probably damaging 1.00
R5214:Slc22a21 UTSW 11 53953043 missense probably damaging 0.99
R6169:Slc22a21 UTSW 11 53958087 missense probably damaging 1.00
R6200:Slc22a21 UTSW 11 53958038 missense probably damaging 1.00
R6767:Slc22a21 UTSW 11 53979502 missense probably damaging 1.00
R6845:Slc22a21 UTSW 11 53979640 missense probably benign 0.01
R7109:Slc22a21 UTSW 11 53979503 missense possibly damaging 0.88
R7402:Slc22a21 UTSW 11 53960400 missense probably benign 0.00
R8515:Slc22a21 UTSW 11 53956078 missense possibly damaging 0.64
R8669:Slc22a21 UTSW 11 53979817 nonsense probably null
R8911:Slc22a21 UTSW 11 53955983 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTCCAGGACAGATGCTTGTTAG -3'
(R):5'- GCCCATGAAAGCAGCAGTTC -3'

Sequencing Primer
(F):5'- GACAGATGCTTGTTAGACACAATGCC -3'
(R):5'- GCAACTGATGGGTATCTTTG -3'
Posted On2017-01-03