Incidental Mutation 'R5698:Appbp2'
ID450806
Institutional Source Beutler Lab
Gene Symbol Appbp2
Ensembl Gene ENSMUSG00000018481
Gene Nameamyloid beta precursor protein (cytoplasmic tail) binding protein 2
SynonymsPAT1, 1300003O07Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location85187262-85235130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85210099 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 171 (H171Q)
Ref Sequence ENSEMBL: ENSMUSP00000018625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018625]
Predicted Effect probably damaging
Transcript: ENSMUST00000018625
AA Change: H171Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: H171Q

DomainStartEndE-ValueType
Pfam:TPR_12 395 461 6.5e-13 PFAM
Pfam:TPR_10 428 467 1.1e-9 PFAM
Pfam:TPR_7 432 466 1.2e-5 PFAM
Pfam:TPR_10 470 509 8.9e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Appbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Appbp2 APN 11 85214317 missense possibly damaging 0.86
IGL02112:Appbp2 APN 11 85201620 missense probably benign 0.04
IGL03051:Appbp2 APN 11 85191739 missense possibly damaging 0.90
IGL03068:Appbp2 APN 11 85201420 missense probably damaging 1.00
IGL03260:Appbp2 APN 11 85216457 missense probably benign 0.00
IGL03358:Appbp2 APN 11 85210034 missense probably benign 0.17
R0017:Appbp2 UTSW 11 85214303 missense possibly damaging 0.46
R0267:Appbp2 UTSW 11 85201462 missense probably damaging 1.00
R0504:Appbp2 UTSW 11 85191687 missense probably benign 0.05
R1661:Appbp2 UTSW 11 85210110 critical splice acceptor site probably null
R3438:Appbp2 UTSW 11 85198140 missense probably damaging 1.00
R3817:Appbp2 UTSW 11 85198108 missense probably damaging 1.00
R3950:Appbp2 UTSW 11 85194706 missense probably damaging 1.00
R4273:Appbp2 UTSW 11 85234676 missense probably damaging 1.00
R4574:Appbp2 UTSW 11 85209938 critical splice donor site probably null
R4948:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5322:Appbp2 UTSW 11 85196064 critical splice donor site probably null
R5581:Appbp2 UTSW 11 85210095 missense possibly damaging 0.92
R5593:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R7095:Appbp2 UTSW 11 85234727 nonsense probably null
R7141:Appbp2 UTSW 11 85191751 nonsense probably null
X0058:Appbp2 UTSW 11 85201630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACTTACCTCATCATAGTGG -3'
(R):5'- TTAGCACATGTTGGGTACACAAAC -3'

Sequencing Primer
(F):5'- CATAGTGGCTTTTTGCAAACAGGAG -3'
(R):5'- CTGGACGAGATTAATCACAAAAAGC -3'
Posted On2017-01-03