Incidental Mutation 'R5698:Fkbp10'
ID450808
Institutional Source Beutler Lab
Gene Symbol Fkbp10
Ensembl Gene ENSMUSG00000001555
Gene NameFK506 binding protein 10
SynonymsFkbp6, Fkbp-rs1, Fkbp1-rs, FKBP65, 65kDa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100415697-100424824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100423526 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 384 (W384L)
Ref Sequence ENSEMBL: ENSMUSP00000103023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001595] [ENSMUST00000107398] [ENSMUST00000107399] [ENSMUST00000107400]
Predicted Effect probably damaging
Transcript: ENSMUST00000001595
AA Change: W496L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001595
Gene: ENSMUSG00000001555
AA Change: W496L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 5.4e-30 PFAM
Pfam:FKBP_C 166 258 4e-29 PFAM
Pfam:FKBP_C 278 370 2.3e-28 PFAM
Pfam:FKBP_C 391 482 6.2e-26 PFAM
EFh 503 528 2.16e0 SMART
EFh 545 573 2.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107398
SMART Domains Protein: ENSMUSP00000103021
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107399
SMART Domains Protein: ENSMUSP00000103022
Gene: ENSMUSG00000017176

DomainStartEndE-ValueType
Pfam:UMPH-1 44 261 3.5e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107400
AA Change: W384L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103023
Gene: ENSMUSG00000001555
AA Change: W384L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:FKBP_C 54 146 1.4e-29 PFAM
Pfam:FKBP_C 166 258 2e-29 PFAM
Pfam:FKBP_C 279 370 4.9e-26 PFAM
EFh 391 416 2.16e0 SMART
EFh 433 461 2.04e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125616
Predicted Effect probably benign
Transcript: ENSMUST00000134815
SMART Domains Protein: ENSMUSP00000123577
Gene: ENSMUSG00000001555

DomainStartEndE-ValueType
Pfam:FKBP_C 34 65 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139084
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. This protein localizes to the endoplasmic reticulum and acts as a molecular chaperone. Alternatively spliced variants encoding different isoforms have been reported, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice do not survive birth, and embryos exhibit delayed growth, tissue fragility, decreased aorta wall thickness, craniofacial and forelimb anomalies, and connective tissue alterations. Mutant MEFs retain procollagen in the cell layer and show dilated endoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Fkbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fkbp10 APN 11 100421817 missense probably benign 0.00
IGL02390:Fkbp10 APN 11 100416017 missense probably damaging 1.00
IGL02424:Fkbp10 APN 11 100415956 missense probably damaging 1.00
IGL02728:Fkbp10 APN 11 100415977 missense probably damaging 1.00
IGL02737:Fkbp10 APN 11 100422655 missense probably benign 0.25
IGL03143:Fkbp10 APN 11 100422754 missense probably benign 0.06
R0479:Fkbp10 UTSW 11 100415914 missense probably damaging 1.00
R1733:Fkbp10 UTSW 11 100423931 missense probably benign 0.20
R1817:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1819:Fkbp10 UTSW 11 100415889 missense probably benign 0.13
R1831:Fkbp10 UTSW 11 100423219 missense probably damaging 1.00
R1997:Fkbp10 UTSW 11 100416015 missense probably damaging 1.00
R2017:Fkbp10 UTSW 11 100421673 missense possibly damaging 0.77
R3758:Fkbp10 UTSW 11 100422625 critical splice acceptor site probably null
R5163:Fkbp10 UTSW 11 100423099 missense probably benign 0.03
R5437:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R5666:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5696:Fkbp10 UTSW 11 100423526 missense probably damaging 1.00
R5706:Fkbp10 UTSW 11 100421023 missense probably damaging 1.00
R7084:Fkbp10 UTSW 11 100421303 missense possibly damaging 0.56
R7405:Fkbp10 UTSW 11 100415881 missense probably damaging 1.00
R7780:Fkbp10 UTSW 11 100421222 missense probably damaging 1.00
R8237:Fkbp10 UTSW 11 100415959 missense probably damaging 1.00
R8886:Fkbp10 UTSW 11 100422036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCATCTCAGGCCTTGGC -3'
(R):5'- AATGCATGGAGCTCAGCAG -3'

Sequencing Primer
(F):5'- TTAGGATGGTTAAACACCCCGTG -3'
(R):5'- CATGGAGCTCAGCAGAGGGG -3'
Posted On2017-01-03