Incidental Mutation 'R5698:Has2'
ID450812
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Namehyaluronan synthase 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location56665627-56694539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56667916 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 468 (R468G)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
Predicted Effect probably damaging
Transcript: ENSMUST00000050544
AA Change: R468G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: R468G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56681676 missense possibly damaging 0.51
IGL02027:Has2 APN 15 56668171 missense probably damaging 1.00
IGL02178:Has2 APN 15 56682060 missense probably damaging 1.00
IGL02493:Has2 APN 15 56667924 missense probably damaging 1.00
IGL02533:Has2 APN 15 56681695 missense probably benign 0.00
IGL03142:Has2 APN 15 56682095 missense possibly damaging 0.92
IGL03240:Has2 APN 15 56668260 missense probably damaging 1.00
R0189:Has2 UTSW 15 56668435 missense probably damaging 1.00
R0362:Has2 UTSW 15 56681661 missense probably damaging 1.00
R1377:Has2 UTSW 15 56681806 missense probably damaging 1.00
R1762:Has2 UTSW 15 56681610 missense probably benign 0.13
R1845:Has2 UTSW 15 56668578 missense probably damaging 1.00
R2012:Has2 UTSW 15 56667868 missense probably damaging 1.00
R2190:Has2 UTSW 15 56667787 missense probably benign 0.00
R2656:Has2 UTSW 15 56681828 missense possibly damaging 0.90
R2966:Has2 UTSW 15 56682137 missense probably damaging 1.00
R4361:Has2 UTSW 15 56681948 missense probably damaging 1.00
R5826:Has2 UTSW 15 56668102 missense probably damaging 1.00
R5883:Has2 UTSW 15 56668063 missense possibly damaging 0.49
R5942:Has2 UTSW 15 56667796 nonsense probably null
R6433:Has2 UTSW 15 56667798 missense possibly damaging 0.79
R6560:Has2 UTSW 15 56668264 missense probably damaging 1.00
R6603:Has2 UTSW 15 56668572 missense probably damaging 1.00
R7094:Has2 UTSW 15 56681621 missense probably damaging 1.00
R7597:Has2 UTSW 15 56668421 missense probably damaging 1.00
R7738:Has2 UTSW 15 56667712 missense possibly damaging 0.89
R8060:Has2 UTSW 15 56669945 missense probably benign 0.00
Z1177:Has2 UTSW 15 56681583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGCATGACCCAGTAGCATG -3'
(R):5'- GTCATCCAGCTCTTCTACAGG -3'

Sequencing Primer
(F):5'- TGACCCAGTAGCATGCATAG -3'
(R):5'- CAGCTCTTCTACAGGGGTAAAATCTG -3'
Posted On2017-01-03