Incidental Mutation 'R5698:Ttll8'
ID450814
Institutional Source Beutler Lab
Gene Symbol Ttll8
Ensembl Gene ENSMUSG00000022388
Gene Nametubulin tyrosine ligase-like family, member 8
Synonyms1700019P01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88890633-88954418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88939006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 85 (S85T)
Ref Sequence ENSEMBL: ENSMUSP00000135381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109371] [ENSMUST00000177180]
Predicted Effect probably benign
Transcript: ENSMUST00000109371
AA Change: S85T

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104996
Gene: ENSMUSG00000022388
AA Change: S85T

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
Pfam:TTL 324 621 3.9e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177180
AA Change: S85T

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135381
Gene: ENSMUSG00000022388
AA Change: S85T

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177254
AA Change: S79T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Ttll8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ttll8 APN 15 88914153 missense probably benign
IGL00895:Ttll8 APN 15 88933528 missense probably damaging 1.00
IGL01061:Ttll8 APN 15 88917250 missense possibly damaging 0.85
IGL01661:Ttll8 APN 15 88935999 splice site probably benign
IGL01992:Ttll8 APN 15 88915645 missense possibly damaging 0.48
IGL02212:Ttll8 APN 15 88917247 missense probably benign 0.04
IGL02234:Ttll8 APN 15 88914049 missense possibly damaging 0.53
IGL02569:Ttll8 APN 15 88933926 nonsense probably null
IGL02935:Ttll8 APN 15 88914556 missense probably benign 0.10
IGL03064:Ttll8 APN 15 88919594 missense probably benign 0.22
R0969:Ttll8 UTSW 15 88933935 missense probably damaging 1.00
R1637:Ttll8 UTSW 15 88914444 missense probably benign 0.12
R1939:Ttll8 UTSW 15 88915486 missense probably damaging 1.00
R1992:Ttll8 UTSW 15 88914451 missense probably benign 0.00
R2173:Ttll8 UTSW 15 88914597 missense probably damaging 1.00
R2201:Ttll8 UTSW 15 88933953 missense possibly damaging 0.57
R2414:Ttll8 UTSW 15 88936133 splice site probably benign
R2905:Ttll8 UTSW 15 88914477 missense probably benign 0.00
R4159:Ttll8 UTSW 15 88917241 missense probably benign 0.00
R4368:Ttll8 UTSW 15 88914181 missense possibly damaging 0.88
R4395:Ttll8 UTSW 15 88915580 missense possibly damaging 0.80
R4707:Ttll8 UTSW 15 88917090 missense probably damaging 0.99
R4926:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R4983:Ttll8 UTSW 15 88925582 missense probably benign 0.08
R5752:Ttll8 UTSW 15 88932728 missense probably benign 0.00
R5834:Ttll8 UTSW 15 88917246 missense possibly damaging 0.48
R5889:Ttll8 UTSW 15 88933939 missense probably damaging 1.00
R6528:Ttll8 UTSW 15 88914238 missense probably benign 0.03
R6931:Ttll8 UTSW 15 88914304 missense possibly damaging 0.55
R7133:Ttll8 UTSW 15 88915427 missense probably damaging 0.99
R7268:Ttll8 UTSW 15 88934956 critical splice donor site probably null
R7286:Ttll8 UTSW 15 88917239 missense probably benign 0.01
R7502:Ttll8 UTSW 15 88933436 critical splice donor site probably null
R7580:Ttll8 UTSW 15 88933929 missense probably damaging 0.99
R7734:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R7978:Ttll8 UTSW 15 88915362 missense probably benign 0.09
R8074:Ttll8 UTSW 15 88915375 missense probably damaging 1.00
R8351:Ttll8 UTSW 15 88914435 missense probably benign 0.06
R8407:Ttll8 UTSW 15 88914538 missense probably benign 0.01
X0058:Ttll8 UTSW 15 88917130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATATGGGAGGAAGTCATCC -3'
(R):5'- TAGAGAAAGGTTCAAGACTACCC -3'

Sequencing Primer
(F):5'- GAAGTCATCCAGTCAGGCC -3'
(R):5'- GGTTCAAGACTACCCAGTGCAG -3'
Posted On2017-01-03