Incidental Mutation 'R5698:Ddx39b'
ID450820
Institutional Source Beutler Lab
Gene Symbol Ddx39b
Ensembl Gene ENSMUSG00000019432
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
SynonymsD17H6S81E-1, Bat1, Bat1a, Bat-1, 0610030D10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35241746-35253707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35251311 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000133428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068056] [ENSMUST00000172549] [ENSMUST00000173731] [ENSMUST00000174757]
Predicted Effect probably benign
Transcript: ENSMUST00000068056
AA Change: V267A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070682
Gene: ENSMUSG00000019432
AA Change: V267A

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083339
Predicted Effect probably benign
Transcript: ENSMUST00000172549
AA Change: V267A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134178
Gene: ENSMUSG00000019432
AA Change: V267A

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173731
AA Change: V267A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133428
Gene: ENSMUSG00000019432
AA Change: V267A

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174164
Predicted Effect probably benign
Transcript: ENSMUST00000174757
SMART Domains Protein: ENSMUSP00000133705
Gene: ENSMUSG00000019432

DomainStartEndE-ValueType
DEXDc 1 147 2.85e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183361
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box family of RNA-dependent ATPases that mediate ATP hydrolysis during pre-mRNA splicing. The encoded protein is an essential splicing factor required for association of U2 small nuclear ribonucleoprotein with pre-mRNA, and it also plays an important role in mRNA export from the nucleus to the cytoplasm. This gene belongs to a cluster of genes localized in the vicinity of the genes encoding tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. Mutations in this gene may be associated with rheumatoid arthritis. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on both chromosomes 6 and 11. Read-through transcription also occurs between this gene and the upstream ATP6V1G2 (ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Ddx39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ddx39b APN 17 35246961 missense probably benign
IGL02932:Ddx39b APN 17 35253361 unclassified probably benign
R4111:Ddx39b UTSW 17 35243364 missense possibly damaging 0.93
R4133:Ddx39b UTSW 17 35253089 missense probably damaging 1.00
R4654:Ddx39b UTSW 17 35253488 makesense probably null
R5083:Ddx39b UTSW 17 35253029 missense possibly damaging 0.50
R7060:Ddx39b UTSW 17 35252750 missense probably damaging 0.96
R7073:Ddx39b UTSW 17 35252850 missense probably benign 0.00
R7087:Ddx39b UTSW 17 35253049 missense probably damaging 1.00
R7159:Ddx39b UTSW 17 35247010 missense probably benign 0.07
R7251:Ddx39b UTSW 17 35253488 makesense probably null
R7554:Ddx39b UTSW 17 35247030 missense probably benign 0.00
R7748:Ddx39b UTSW 17 35252750 missense probably damaging 0.96
R8811:Ddx39b UTSW 17 35244459 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAGCAGAGTCTTCTTTGTGG -3'
(R):5'- ACTTGGGACTTGCTCCATCC -3'

Sequencing Primer
(F):5'- GAGGGGTTTTCAGTCTTCTCTCTC -3'
(R):5'- GACTTGCTCCATCCACCGATTC -3'
Posted On2017-01-03