Incidental Mutation 'R5698:Ighmbp2'
ID450823
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3274538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 243 (S243P)
Ref Sequence ENSEMBL: ENSMUSP00000113438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025751
AA Change: S243P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: S243P

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119292
AA Change: S243P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: S243P

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154537
AA Change: L210P
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831
AA Change: L210P

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7819:Ighmbp2 UTSW 19 3267276 missense possibly damaging 0.46
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
R7960:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3265635 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3267242 missense probably null 1.00
Z1177:Ighmbp2 UTSW 19 3271665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCTTCTGATGTCAGCAAC -3'
(R):5'- ACATTCAGTGTTTGGGAGATGC -3'

Sequencing Primer
(F):5'- AACAATCTGGGCGTTGTCAC -3'
(R):5'- ATGCATAGGCTGTGGCTCTCC -3'
Posted On2017-01-03